EMAIL THIS PAGE TO A FRIEND

ATP1A2

ATPase, Na+/K+ transporting, alpha 2 polypeptide

118 Gene Product Result for
Synonyms: FHM2 MHP2
UniProtKB ID: P50993, D3DVE4, Q07059, Q5JW74, Q86UZ5, Q9UQ25
Gene ID:
Human(477) Summary: The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 2 subunit. Mutations in this gene result in familial basilar or hemiplegic migraines, and in a rare syndrome known as alternating hemiplegia of childhood. [provided by RefSeq, Oct 2008]
Mouse(98660) ATPase, Na+/K+ transporting, alpha 2 polypeptide
Rat(24212) ATPase, Na+/K+ transporting, alpha 2 polypeptide
chicken(396468) ATPase, Na+/K+ transporting, alpha 2 polypeptide
domestic cat(101096785) ATPase, Na+/K+ transporting, alpha 2 polypeptide
cow(515161) ATPase, Na+/K+ transporting, alpha 2 polypeptide
Horse(100058251) ATPase, Na+/K+ transporting, alpha 2 polypeptide
dog(488636) ATPase, Na+/K+ transporting, alpha 2 polypeptide
domestic guinea pig(100729524) ATPase, Na+/K+ transporting, alpha 2 polypeptide
naked mole-rat(101721770) ATPase, Na+/K+ transporting, alpha 2 polypeptide
sheep(101118148) ATPase, Na+/K+ transporting, alpha 2 polypeptide
Domestic Rabbit(100008756) ATPase, Na+/K+ transporting, alpha 2 polypeptide
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A8235 Anti-ATP1A2 (566-580) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1302828 ANTI-ATP1A2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000702 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134991 MISSION® esiRNA esiRNA human ATP1A2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000702 Rosetta Predictions human pricing
NM_012505 Rosetta Predictions rat pricing
NM_178405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059326 predicted 1763
2 SASI_Hs01_00059327 predicted 944
3 SASI_Hs01_00059328 predicted 1408
4 SASI_Hs01_00059329 predicted 469
5 SASI_Hs01_00059330 predicted 862
6 SASI_Hs01_00059331 predicted 2580
7 SASI_Hs01_00059332 predicted 1791
8 SASI_Hs01_00059333 predicted 946
9 SASI_Hs01_00059334 predicted 1797
10 SASI_Hs02_00303105 predicted 1530
11 SASI_Hs01_00059335 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043584 predicted 723
2 SASI_Rn01_00043585 predicted 1517
3 SASI_Rn01_00043586 predicted 1687
4 SASI_Rn01_00043588 predicted 1402
5 SASI_Rn01_00043589 predicted 546
6 SASI_Rn01_00043590 predicted 2037
7 SASI_Rn01_00043591 predicted 3153
8 SASI_Rn01_00043592 predicted 3150
9 SASI_Rn01_00043593 predicted 999
10 SASI_Rn02_00259558 predicted 2526
11 SASI_Rn01_00043587 predicted 1539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139387 predicted 334
2 SASI_Mm01_00139389 predicted 2142
3 SASI_Mm01_00139390 predicted 1856
4 SASI_Mm01_00139391 predicted 1477
5 SASI_Mm01_00139392 predicted 538
6 SASI_Mm01_00139393 predicted 495
7 SASI_Mm01_00139394 predicted 2485
8 SASI_Mm02_00348837 predicted 1025
9 SASI_Mm01_00139395 predicted 2607
10 SASI_Mm01_00139396 predicted 2212
11 SASI_Mm01_00139388 predicted 2603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000702
ATP1A2 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, alpha 2 polypeptide
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000702.3-838s21c1
Sequence:CCGGGAGACCCGCAATATCTGTTTCCTCGAGGAAACAGATATTGCGGGTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000702.3-3387s21c1
Sequence:CCGGACAATCAGATTAGACACTATGCTCGAGCATAGTGTCTAATCTGATTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000702.1-2138s1c1
Sequence:CCGGCCTCAAGAACCACACAGAGATCTCGAGATCTCTGTGTGGTTCTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000702.1-471s1c1
Sequence:CCGGCCATCCAACGACAATCTATATCTCGAGATATAGATTGTCGTTGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000702.1-3091s1c1
Sequence:CCGGTCATCTATGATGAGGTCCGAACTCGAGTTCGGACCTCATCATAGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000702.1-1535s1c1
Sequence:CCGGGATTCCTTTCAACTCTACCAACTCGAGTTGGTAGAGTTGAAAGGAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000702
ATP1A2 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, alpha 2 polypeptide
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000702.3-838s21c1
Sequence:CCGGGAGACCCGCAATATCTGTTTCCTCGAGGAAACAGATATTGCGGGTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000702.3-3387s21c1
Sequence:CCGGACAATCAGATTAGACACTATGCTCGAGCATAGTGTCTAATCTGATTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000702.1-2138s1c1
Sequence:CCGGCCTCAAGAACCACACAGAGATCTCGAGATCTCTGTGTGGTTCTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000702.1-471s1c1
Sequence:CCGGCCATCCAACGACAATCTATATCTCGAGATATAGATTGTCGTTGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000702.1-3091s1c1
Sequence:CCGGTCATCTATGATGAGGTCCGAACTCGAGTTCGGACCTCATCATAGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000702.1-1535s1c1
Sequence:CCGGGATTCCTTTCAACTCTACCAACTCGAGTTGGTAGAGTTGAAAGGAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000702
ATP1A2 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, alpha 2 polypeptide
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000702.3-838s21c1
Sequence:CCGGGAGACCCGCAATATCTGTTTCCTCGAGGAAACAGATATTGCGGGTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412972    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000702.3-3387s21c1
Sequence:CCGGACAATCAGATTAGACACTATGCTCGAGCATAGTGTCTAATCTGATTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000702.1-2138s1c1
Sequence:CCGGCCTCAAGAACCACACAGAGATCTCGAGATCTCTGTGTGGTTCTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000702.1-471s1c1
Sequence:CCGGCCATCCAACGACAATCTATATCTCGAGATATAGATTGTCGTTGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000702.1-3091s1c1
Sequence:CCGGTCATCTATGATGAGGTCCGAACTCGAGTTCGGACCTCATCATAGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000702.1-1535s1c1
Sequence:CCGGGATTCCTTTCAACTCTACCAACTCGAGTTGGTAGAGTTGAAAGGAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178405
ATP1A2 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, alpha 2 polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-2542s1c1
Sequence:CCGGGCTATCTCATTAGCATACGAACTCGAGTTCGTATGCTAATGAGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-459s1c1
Sequence:CCGGCGAACCATCCAATGATAATTTCTCGAGAAATTATCATTGGATGGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-1672s1c1
Sequence:CCGGCCTCTTGACAAGGAGATGCAACTCGAGTTGCATCTCCTTGTCAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-1969s1c1
Sequence:CCGGGCCAAAGGTGTGGGCATTATACTCGAGTATAATGCCCACACCTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-2457s1c1
Sequence:CCGGCCTGCTGTTCATCATTGCCAACTCGAGTTGGCAATGATGAACAGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178405
ATP1A2 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, alpha 2 polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-2542s1c1
Sequence:CCGGGCTATCTCATTAGCATACGAACTCGAGTTCGTATGCTAATGAGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-459s1c1
Sequence:CCGGCGAACCATCCAATGATAATTTCTCGAGAAATTATCATTGGATGGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-1672s1c1
Sequence:CCGGCCTCTTGACAAGGAGATGCAACTCGAGTTGCATCTCCTTGTCAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-1969s1c1
Sequence:CCGGGCCAAAGGTGTGGGCATTATACTCGAGTATAATGCCCACACCTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-2457s1c1
Sequence:CCGGCCTGCTGTTCATCATTGCCAACTCGAGTTGGCAATGATGAACAGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178405
ATP1A2 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, alpha 2 polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-2542s1c1
Sequence:CCGGGCTATCTCATTAGCATACGAACTCGAGTTCGTATGCTAATGAGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-459s1c1
Sequence:CCGGCGAACCATCCAATGATAATTTCTCGAGAAATTATCATTGGATGGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-1672s1c1
Sequence:CCGGCCTCTTGACAAGGAGATGCAACTCGAGTTGCATCTCCTTGTCAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-1969s1c1
Sequence:CCGGGCCAAAGGTGTGGGCATTATACTCGAGTATAATGCCCACACCTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178405.2-2457s1c1
Sequence:CCGGCCTGCTGTTCATCATTGCCAACTCGAGTTGGCAATGATGAACAGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)