EMAIL THIS PAGE TO A FRIEND

ATP1A3

ATPase, Na+/K+ transporting, alpha 3 polypeptide

65 Gene Product Result for
Synonyms: AHC2 DYT12 RDP
Gene ID:
Human(478) Summary: The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 3 subunit. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(232975) ATPase, Na+/K+ transporting, alpha 3 polypeptide
Rat(24213) ATPase, Na+/K+ transporting, alpha 3 polypeptide
chicken(396467) ATPase, Na+/K+ transporting, alpha 3 polypeptide
cow(282598) ATPase, Na+/K+ transporting, alpha 3 polypeptide
Horse(100069796) ATPase, Na+/K+ transporting, alpha 3 polypeptide
domestic cat(101083636) ATPase, Na+/K+ transporting, alpha 3 polypeptide
dog(612463) ATPase, Na+/K+ transporting, alpha 3 polypeptide
sheep(101103751) ATPase, Na+/K+ transporting, alpha 3 polypeptide
naked mole-rat(101721146) ATPase, Na+/K+ transporting, alpha 3 polypeptide
domestic guinea pig(100712985) ATPase, Na+/K+ transporting, alpha 3 polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144921 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144921 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144921 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152296 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152296 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152296 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152296 Rosetta Predictions human pricing
NM_012506 Rosetta Predictions rat pricing
NM_144921 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152296 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00227249 predicted 3099
2 SASI_Hs02_00365862 predicted 1048
3 SASI_Hs01_00227250 predicted 3112
4 SASI_Hs01_00227251 predicted 1628
5 SASI_Hs01_00227252 predicted 2798
6 SASI_Hs01_00227253 predicted 1551
7 SASI_Hs01_00227254 predicted 2644
8 SASI_Hs01_00227255 predicted 2877
9 SASI_Hs01_00227256 predicted 3126
10 SASI_Hs01_00227257 predicted 2648
11 SASI_Hs01_00227258 predicted 1776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00079801 predicted 2903
2 SASI_Rn01_00079802 predicted 1167
3 SASI_Rn01_00079803 predicted 3160
4 SASI_Rn01_00079804 predicted 495
5 SASI_Rn01_00079805 predicted 1418
6 SASI_Rn02_00259559 predicted 214
7 SASI_Rn01_00079807 predicted 1040
8 SASI_Rn01_00079808 predicted 2951
9 SASI_Rn01_00079809 predicted 2000
10 SASI_Rn01_00079810 predicted 574
11 SASI_Rn01_00079806 predicted 1559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144921 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178299 predicted 2941
2 SASI_Mm01_00178300 predicted 488
3 SASI_Mm01_00178301 predicted 1566
4 SASI_Mm01_00178302 predicted 2813
5 SASI_Mm01_00178303 predicted 1499
6 SASI_Mm01_00178304 predicted 1526
7 SASI_Mm01_00178305 predicted 1538
8 SASI_Mm01_00178306 predicted 2625
9 SASI_Mm01_00178307 predicted 3209
10 SASI_Mm01_00178308 predicted 1540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144921
VALIDATED
ATP1A3 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, alpha 3 polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144921.1-3848s1c1
Sequence:CCGGCGGTTCTAATTCTGAACAATTCTCGAGAATTGTTCAGAATTAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144921.1-1761s1c1
Sequence:CCGGGCTGGGTTTCTGCCATTACTACTCGAGTAGTAATGGCAGAAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144921.1-1029s1c1
Sequence:CCGGCCTCTCTCTCATTCTGGGTTACTCGAGTAACCCAGAATGAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144921.1-232s1c1
Sequence:CCGGGAGCACAAGATGTCAGTAGAACTCGAGTTCTACTGACATCTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144921.1-2782s1c1
Sequence:CCGGCGCACTGTCAATGACCTAGAACTCGAGTTCTAGGTCATTGACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144921.1-2129s21c1
Sequence:CCGGCGGAGCAGATTGACGAGATTCCTCGAGGAATCTCGTCAATCTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144921.1-3771s21c1
Sequence:CCGGTTGCAACTCTGCCTCTCATTTCTCGAGAAATGAGAGGCAGAGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144921.1-2809s21c1
Sequence:CCGGTATGGGCAGCAGTGGACTTATCTCGAGATAAGTCCACTGCTGCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144921.1-249s21c1
Sequence:CCGGAGAAGAGGTCTGCCGGAAATACTCGAGTATTTCCGGCAGACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144921.1-2782s21c1
Sequence:CCGGCGCACTGTCAATGACCTAGAACTCGAGTTCTAGGTCATTGACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144921
VALIDATED
ATP1A3 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, alpha 3 polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144921.1-3848s1c1
Sequence:CCGGCGGTTCTAATTCTGAACAATTCTCGAGAATTGTTCAGAATTAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144921.1-1761s1c1
Sequence:CCGGGCTGGGTTTCTGCCATTACTACTCGAGTAGTAATGGCAGAAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144921.1-1029s1c1
Sequence:CCGGCCTCTCTCTCATTCTGGGTTACTCGAGTAACCCAGAATGAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144921.1-232s1c1
Sequence:CCGGGAGCACAAGATGTCAGTAGAACTCGAGTTCTACTGACATCTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144921.1-2782s1c1
Sequence:CCGGCGCACTGTCAATGACCTAGAACTCGAGTTCTAGGTCATTGACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144921.1-2129s21c1
Sequence:CCGGCGGAGCAGATTGACGAGATTCCTCGAGGAATCTCGTCAATCTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144921.1-3771s21c1
Sequence:CCGGTTGCAACTCTGCCTCTCATTTCTCGAGAAATGAGAGGCAGAGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144921.1-2809s21c1
Sequence:CCGGTATGGGCAGCAGTGGACTTATCTCGAGATAAGTCCACTGCTGCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144921.1-249s21c1
Sequence:CCGGAGAAGAGGTCTGCCGGAAATACTCGAGTATTTCCGGCAGACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144921.1-2782s21c1
Sequence:CCGGCGCACTGTCAATGACCTAGAACTCGAGTTCTAGGTCATTGACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144921
VALIDATED
ATP1A3 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, alpha 3 polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101780    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144921.1-3848s1c1
Sequence:CCGGCGGTTCTAATTCTGAACAATTCTCGAGAATTGTTCAGAATTAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144921.1-1761s1c1
Sequence:CCGGGCTGGGTTTCTGCCATTACTACTCGAGTAGTAATGGCAGAAACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144921.1-1029s1c1
Sequence:CCGGCCTCTCTCTCATTCTGGGTTACTCGAGTAACCCAGAATGAGAGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144921.1-232s1c1
Sequence:CCGGGAGCACAAGATGTCAGTAGAACTCGAGTTCTACTGACATCTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144921.1-2782s1c1
Sequence:CCGGCGCACTGTCAATGACCTAGAACTCGAGTTCTAGGTCATTGACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144921.1-2129s21c1
Sequence:CCGGCGGAGCAGATTGACGAGATTCCTCGAGGAATCTCGTCAATCTGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349818    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144921.1-3771s21c1
Sequence:CCGGTTGCAACTCTGCCTCTCATTTCTCGAGAAATGAGAGGCAGAGTTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349819    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144921.1-2809s21c1
Sequence:CCGGTATGGGCAGCAGTGGACTTATCTCGAGATAAGTCCACTGCTGCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144921.1-249s21c1
Sequence:CCGGAGAAGAGGTCTGCCGGAAATACTCGAGTATTTCCGGCAGACCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144921.1-2782s21c1
Sequence:CCGGCGCACTGTCAATGACCTAGAACTCGAGTTCTAGGTCATTGACAGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152296
VALIDATED
ATP1A3 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, alpha 3 polypeptide
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_152296.3-3378s1c1
Sequence:CCGGCAAACCTCTCTCCTCTCTCTTCTCGAGAAGAGAGAGGAGAGAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152296.3-2642s1c1
Sequence:CCGGCGGACGGACAAATTGGTCAATCTCGAGATTGACCAATTTGTCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_152296.3-3127s1c1
Sequence:CCGGCGACGAAATCCGCAAACTCATCTCGAGATGAGTTTGCGGATTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152296.3-1837s1c1
Sequence:CCGGCGACTGTGATGACGTGAACTTCTCGAGAAGTTCACGTCATCACAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_152296.3-2885s1c1
Sequence:CCGGGCCTTCTTTGTGAGCATCGTTCTCGAGAACGATGCTCACAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152296
VALIDATED
ATP1A3 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, alpha 3 polypeptide
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_152296.3-3378s1c1
Sequence:CCGGCAAACCTCTCTCCTCTCTCTTCTCGAGAAGAGAGAGGAGAGAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152296.3-2642s1c1
Sequence:CCGGCGGACGGACAAATTGGTCAATCTCGAGATTGACCAATTTGTCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_152296.3-3127s1c1
Sequence:CCGGCGACGAAATCCGCAAACTCATCTCGAGATGAGTTTGCGGATTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152296.3-1837s1c1
Sequence:CCGGCGACTGTGATGACGTGAACTTCTCGAGAAGTTCACGTCATCACAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_152296.3-2885s1c1
Sequence:CCGGGCCTTCTTTGTGAGCATCGTTCTCGAGAACGATGCTCACAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152296
VALIDATED
ATP1A3 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, alpha 3 polypeptide
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072783    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_152296.3-3378s1c1
Sequence:CCGGCAAACCTCTCTCCTCTCTCTTCTCGAGAAGAGAGAGGAGAGAGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152296.3-2642s1c1
Sequence:CCGGCGGACGGACAAATTGGTCAATCTCGAGATTGACCAATTTGTCCGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_152296.3-3127s1c1
Sequence:CCGGCGACGAAATCCGCAAACTCATCTCGAGATGAGTTTGCGGATTTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072785    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152296.3-1837s1c1
Sequence:CCGGCGACTGTGATGACGTGAACTTCTCGAGAAGTTCACGTCATCACAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_152296.3-2885s1c1
Sequence:CCGGGCCTTCTTTGTGAGCATCGTTCTCGAGAACGATGCTCACAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks