EMAIL THIS PAGE TO A FRIEND

ATP1B1

ATPase, Na+/K+ transporting, beta 1 polypeptide

170 Gene Product Result for
Synonyms: ATP1B
UniProtKB ID: P05026, Q5TGZ3
Gene ID:
Human(481) Summary: The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 1 subunit. Alternatively spliced transcript variants encoding different isoforms have been described, but their biological validity is not known. [provided by RefSeq, Mar 2010]
Mouse(11931) ATPase, Na+/K+ transporting, beta 1 polypeptide
Rat(25650) ATPase, Na+/K+ transporting, beta 1 polypeptide
sheep(443384) ATPase, Na+/K+ transporting, beta 1 polypeptide
Domestic Rabbit(100008749) ATPase, Na+/K+ transporting, beta 1 polypeptide
naked mole-rat(101701102) ATPase, Na+/K+ transporting, beta 1 polypeptide
domestic guinea pig(100135483) ATPase, Na+/K+ transporting, beta 1 polypeptide
chicken(396529) ATPase, Na+/K+ transporting, beta 1 polypeptide
dog(403966) ATPase, Na+/K+ transporting, beta 1 polypeptide
domestic cat(101081858) ATPase, Na+/K+ transporting, beta 1 polypeptide
cow(519758) ATPase, Na+/K+ transporting, beta 1 polypeptide
Horse(100033968) ATPase, Na+/K+ transporting, beta 1 polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501588 Anti-ATP1B1 antibody produced in goat affinity isolated antibody, buffered aqueous solution bovine, pig, mouse, rat, canine, human
ELISA, western blot pricing
SAB2108027 Anti-ATP1B1 antibody produced in rabbit affinity isolated antibody human, pig, rabbit, canine, rat, guinea pig, rabbit, mouse, horse
immunohistochemistry, western blot pricing
HPA012911 Anti-ATP1B1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
AV44411 Anti-ATP1B1 antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, human, rat, rabbit, pig, horse, mouse, rabbit
immunohistochemistry, western blot pricing
SAB2105573 Anti-ATP1B1, (N-terminal) antibody produced in rabbit affinity isolated antibody human, rabbit, horse, guinea pig, sheep
western blot pricing
A278 Monoclonal Anti-Na+/K+ ATPase (β1 Subunit) antibody produced in mouse clone M17-P5-F11 sheep, canine, human, pig
immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
O3125 Ouabain octahydrate ≥95% (HPLC), powder human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009721 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009721 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009721 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001677 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001677 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001677 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001787 Rosetta Predictions human pricing
NM_001677 Rosetta Predictions human pricing
NM_013113 Rosetta Predictions rat pricing
NM_009721 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076040 predicted 708
2 SASI_Hs01_00076042 predicted 302
3 SASI_Hs01_00076043 predicted 346
4 SASI_Hs01_00076044 predicted 226
5 SASI_Hs01_00076045 predicted 413
6 SASI_Hs01_00076046 predicted 389
7 SASI_Hs01_00076048 predicted 533
8 SASI_Hs02_00303928 predicted 598
9 SASI_Hs02_00303929 predicted 217
10 SASI_Hs02_00303930 predicted 348
11 SASI_Hs01_00076039 predicted 376
12 SASI_Hs01_00076041 predicted 358
13 SASI_Hs01_00076047 predicted 666
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001677 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215918 predicted 700
2 SASI_Hs01_00215920 predicted 299
3 SASI_Hs01_00215921 predicted 350
4 SASI_Hs01_00215922 predicted 217
5 SASI_Hs01_00215923 predicted 418
6 SASI_Hs01_00215924 predicted 390
7 SASI_Hs01_00215926 predicted 533
8 SASI_Hs02_00332322 predicted 598
9 SASI_Hs02_00332323 predicted 214
10 SASI_Hs02_00332324 predicted 346
11 SASI_Hs01_00215917 predicted 383
12 SASI_Hs01_00215919 predicted 365
13 SASI_Hs01_00215925 predicted 669
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013113 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088618 predicted 367
2 SASI_Rn02_00260892 predicted 807
3 SASI_Rn01_00088619 predicted 387
4 SASI_Rn01_00088620 predicted 353
5 SASI_Rn01_00088621 predicted 238
6 SASI_Rn01_00088622 predicted 648
7 SASI_Rn01_00088623 predicted 950
8 SASI_Rn02_00260893 predicted 432
9 SASI_Rn01_00088624 predicted 816
10 SASI_Rn01_00088625 predicted 297
11 SASI_Rn01_00088626 predicted 875
12 SASI_Rn01_00088627 predicted 1114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100518 predicted 751
2 SASI_Mm01_00100519 predicted 1087
3 SASI_Mm01_00100520 predicted 1463
4 SASI_Mm01_00100521 predicted 1148
5 SASI_Mm01_00100522 predicted 586
6 SASI_Mm01_00100524 predicted 1417
7 SASI_Mm01_00100525 predicted 1179
8 SASI_Mm02_00316877 predicted 1095
9 SASI_Mm01_00100526 predicted 1199
10 SASI_Mm01_00100527 predicted 1311
11 SASI_Mm01_00100523 predicted 1123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009721
VALIDATED
ATP1B1 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, beta 1 polypeptide
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009721.2-978s1c1
Sequence:CCGGCCGGTCTCAATGATGACTCTTCTCGAGAAGAGTCATCATTGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009721.2-1066s1c1
Sequence:CCGGGCCTCCCAAGAATGAATCCTTCTCGAGAAGGATTCATTCTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009721.2-604s1c1
Sequence:CCGGCCTTCTGTTCTACGTGATATTCTCGAGAATATCACGTAGAACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009721.2-802s1c1
Sequence:CCGGCGTGCTAAACATCATCAGGTTCTCGAGAACCTGATGATGTTTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009721.2-583s1c1
Sequence:CCGGCGGTGGTAGTTGGTTTAAGATCTCGAGATCTTAAACCAACTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009721.5-603s21c1
Sequence:CCGGCCTTCTGTTCTACGTGATATTCTCGAGAATATCACGTAGAACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009721.5-977s21c1
Sequence:CCGGCCGGTCTCAATGATGACTCTTCTCGAGAAGAGTCATCATTGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009721.5-648s21c1
Sequence:CCGGCATCGGGACCATCCAAGTAATCTCGAGATTACTTGGATGGTCCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009721.5-1497s21c1
Sequence:CCGGACGTATGGGACCTACACTTAACTCGAGTTAAGTGTAGGTCCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009721.5-758s21c1
Sequence:CCGGAGATCTCCTTCCGTCCTAATGCTCGAGCATTAGGACGGAAGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009721
VALIDATED
ATP1B1 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, beta 1 polypeptide
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009721.2-978s1c1
Sequence:CCGGCCGGTCTCAATGATGACTCTTCTCGAGAAGAGTCATCATTGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009721.2-1066s1c1
Sequence:CCGGGCCTCCCAAGAATGAATCCTTCTCGAGAAGGATTCATTCTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009721.2-604s1c1
Sequence:CCGGCCTTCTGTTCTACGTGATATTCTCGAGAATATCACGTAGAACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009721.2-802s1c1
Sequence:CCGGCGTGCTAAACATCATCAGGTTCTCGAGAACCTGATGATGTTTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009721.2-583s1c1
Sequence:CCGGCGGTGGTAGTTGGTTTAAGATCTCGAGATCTTAAACCAACTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009721.5-603s21c1
Sequence:CCGGCCTTCTGTTCTACGTGATATTCTCGAGAATATCACGTAGAACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009721.5-977s21c1
Sequence:CCGGCCGGTCTCAATGATGACTCTTCTCGAGAAGAGTCATCATTGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009721.5-648s21c1
Sequence:CCGGCATCGGGACCATCCAAGTAATCTCGAGATTACTTGGATGGTCCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009721.5-1497s21c1
Sequence:CCGGACGTATGGGACCTACACTTAACTCGAGTTAAGTGTAGGTCCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009721.5-758s21c1
Sequence:CCGGAGATCTCCTTCCGTCCTAATGCTCGAGCATTAGGACGGAAGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009721
VALIDATED
ATP1B1 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, beta 1 polypeptide
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009721.2-978s1c1
Sequence:CCGGCCGGTCTCAATGATGACTCTTCTCGAGAAGAGTCATCATTGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009721.2-1066s1c1
Sequence:CCGGGCCTCCCAAGAATGAATCCTTCTCGAGAAGGATTCATTCTTGGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009721.2-604s1c1
Sequence:CCGGCCTTCTGTTCTACGTGATATTCTCGAGAATATCACGTAGAACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009721.2-802s1c1
Sequence:CCGGCGTGCTAAACATCATCAGGTTCTCGAGAACCTGATGATGTTTAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009721.2-583s1c1
Sequence:CCGGCGGTGGTAGTTGGTTTAAGATCTCGAGATCTTAAACCAACTACCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009721.5-603s21c1
Sequence:CCGGCCTTCTGTTCTACGTGATATTCTCGAGAATATCACGTAGAACAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009721.5-977s21c1
Sequence:CCGGCCGGTCTCAATGATGACTCTTCTCGAGAAGAGTCATCATTGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009721.5-648s21c1
Sequence:CCGGCATCGGGACCATCCAAGTAATCTCGAGATTACTTGGATGGTCCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294875    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009721.5-1497s21c1
Sequence:CCGGACGTATGGGACCTACACTTAACTCGAGTTAAGTGTAGGTCCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009721.5-758s21c1
Sequence:CCGGAGATCTCCTTCCGTCCTAATGCTCGAGCATTAGGACGGAAGGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001677
VALIDATED
ATP1B1 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, beta 1 polypeptide
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001677.2-170s1c1
Sequence:CCGGCGGTGGCAGTTGGTTTAAGATCTCGAGATCTTAAACCAACTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001677.2-687s1c1
Sequence:CCGGGTGATGAAGTATAACCCAAATCTCGAGATTTGGGTTATACTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001677.2-369s1c1
Sequence:CCGGCCCAAGAGCTATGAGGCATATCTCGAGATATGCCTCATAGCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001677.2-260s1c1
Sequence:CCGGGCTCACCATCAGTGAATTTAACTCGAGTTAAATTCACTGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001677.2-864s1c1
Sequence:CCGGGCCGTACAGTTCACCAATCTTCTCGAGAAGATTGGTGAACTGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-1123s21c1
Sequence:CCGGACGTATGGGACCTACACTTAACTCGAGTTAAGTGTAGGTCCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-722s21c1
Sequence:CCGGGTGATGAAGTATAACCCAAATCTCGAGATTTGGGTTATACTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-295s21c1
Sequence:CCGGGCTCACCATCAGTGAATTTAACTCGAGTTAAATTCACTGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-899s21c1
Sequence:CCGGGCCGTACAGTTCACCAATCTTCTCGAGAAGATTGGTGAACTGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-790s21c1
Sequence:CCGGAGTTGGAAATGTGGAGTATTTCTCGAGAAATACTCCACATTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001677
VALIDATED
ATP1B1 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, beta 1 polypeptide
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001677.2-170s1c1
Sequence:CCGGCGGTGGCAGTTGGTTTAAGATCTCGAGATCTTAAACCAACTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001677.2-687s1c1
Sequence:CCGGGTGATGAAGTATAACCCAAATCTCGAGATTTGGGTTATACTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001677.2-369s1c1
Sequence:CCGGCCCAAGAGCTATGAGGCATATCTCGAGATATGCCTCATAGCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001677.2-260s1c1
Sequence:CCGGGCTCACCATCAGTGAATTTAACTCGAGTTAAATTCACTGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001677.2-864s1c1
Sequence:CCGGGCCGTACAGTTCACCAATCTTCTCGAGAAGATTGGTGAACTGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-1123s21c1
Sequence:CCGGACGTATGGGACCTACACTTAACTCGAGTTAAGTGTAGGTCCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-722s21c1
Sequence:CCGGGTGATGAAGTATAACCCAAATCTCGAGATTTGGGTTATACTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-295s21c1
Sequence:CCGGGCTCACCATCAGTGAATTTAACTCGAGTTAAATTCACTGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-899s21c1
Sequence:CCGGGCCGTACAGTTCACCAATCTTCTCGAGAAGATTGGTGAACTGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-790s21c1
Sequence:CCGGAGTTGGAAATGTGGAGTATTTCTCGAGAAATACTCCACATTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001677
VALIDATED
ATP1B1 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, beta 1 polypeptide
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001677.2-170s1c1
Sequence:CCGGCGGTGGCAGTTGGTTTAAGATCTCGAGATCTTAAACCAACTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001677.2-687s1c1
Sequence:CCGGGTGATGAAGTATAACCCAAATCTCGAGATTTGGGTTATACTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001677.2-369s1c1
Sequence:CCGGCCCAAGAGCTATGAGGCATATCTCGAGATATGCCTCATAGCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001677.2-260s1c1
Sequence:CCGGGCTCACCATCAGTGAATTTAACTCGAGTTAAATTCACTGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001677.2-864s1c1
Sequence:CCGGGCCGTACAGTTCACCAATCTTCTCGAGAAGATTGGTGAACTGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296896    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-1123s21c1
Sequence:CCGGACGTATGGGACCTACACTTAACTCGAGTTAAGTGTAGGTCCCATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-722s21c1
Sequence:CCGGGTGATGAAGTATAACCCAAATCTCGAGATTTGGGTTATACTTCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-295s21c1
Sequence:CCGGGCTCACCATCAGTGAATTTAACTCGAGTTAAATTCACTGATGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-899s21c1
Sequence:CCGGGCCGTACAGTTCACCAATCTTCTCGAGAAGATTGGTGAACTGTACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296810    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001677.3-790s21c1
Sequence:CCGGAGTTGGAAATGTGGAGTATTTCTCGAGAAATACTCCACATTTCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks