EMAIL THIS PAGE TO A FRIEND

ATP1B2

ATPase, Na+/K+ transporting, beta 2 polypeptide

Synonyms: AMOG
UniProtKB ID: P14415, A0AV17, A8K278, D3DTQ2, O60444
Gene ID:
Human(482) Summary: The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 2 subunit. [provided by RefSeq, Jul 2008]
Mouse(11932) ATPase, Na+/K+ transporting, beta 2 polypeptide
Rat(24214) ATPase, Na+/K+ transporting, beta 2 polypeptide
dog(489479) ATPase, Na+/K+ transporting, beta 2 polypeptide
domestic cat(101100258) ATPase, Na+/K+ transporting, beta 2 polypeptide
cow(282562) ATPase, Na+/K+ transporting, beta 2 polypeptide
Horse(100073014) ATPase, Na+/K+ transporting, beta 2 polypeptide
domestic guinea pig(100733951) ATPase, Na+/K+ transporting, beta 2 polypeptide
naked mole-rat(101701421) ATPase, Na+/K+ transporting, beta 2 polypeptide
sheep(101103490) ATPase, Na+/K+ transporting, beta 2 polypeptide
Domestic Rabbit(100009577) ATPase, Na+/K+ transporting, beta 2 polypeptide
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001678 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001678 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001678 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU028881 MISSION® esiRNA esiRNA human ATP1B2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001678 Rosetta Predictions human pricing
NM_012507 Rosetta Predictions rat pricing
NM_013415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001678 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042173 predicted 1567
2 SASI_Hs01_00042174 predicted 1390
3 SASI_Hs01_00042175 predicted 864
4 SASI_Hs01_00042176 predicted 980
5 SASI_Hs01_00042178 predicted 1238
6 SASI_Hs02_00332325 predicted 975
7 SASI_Hs01_00042179 predicted 842
8 SASI_Hs01_00042180 predicted 1199
9 SASI_Hs01_00042181 predicted 1071
10 SASI_Hs02_00332326 predicted 1479
11 SASI_Hs01_00042172 predicted 1314
12 SASI_Hs01_00042177 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034098 predicted 1297
2 SASI_Rn02_00259560 predicted 1194
3 SASI_Rn01_00034099 predicted 1416
4 SASI_Rn01_00034100 predicted 1355
5 SASI_Rn01_00034101 predicted 1333
6 SASI_Rn01_00034103 predicted 965
7 SASI_Rn01_00034104 predicted 825
8 SASI_Rn01_00034105 predicted 1232
9 SASI_Rn01_00034106 predicted 1232
10 SASI_Rn01_00034107 predicted 1322
11 SASI_Rn01_00034102 predicted 1357
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109093 predicted 980
2 SASI_Mm01_00109094 predicted 1180
3 SASI_Mm01_00109095 predicted 1256
4 SASI_Mm01_00109096 predicted 848
5 SASI_Mm01_00109097 predicted 984
6 SASI_Mm01_00109098 predicted 736
7 SASI_Mm01_00109099 predicted 1363
8 SASI_Mm01_00109100 predicted 1366
9 SASI_Mm01_00109101 predicted 1162
10 SASI_Mm01_00109102 predicted 1252
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001678
VALIDATED
ATP1B2 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, beta 2 polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001678.3-1354s21c1
Sequence:CCGGGAATGTAGAATGTCGCATCAACTCGAGTTGATGCGACATTCTACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001678.3-1843s21c1
Sequence:CCGGACGTGCACACGCGTCTCATTTCTCGAGAAATGAGACGCGTGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001678.3-1111s21c1
Sequence:CCGGCTGTGTCTTCATCAAGATGAACTCGAGTTCATCTTGATGAAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001678.3-984s21c1
Sequence:CCGGATTACGAACAGCCAGATAATGCTCGAGCATTATCTGGCTGTTCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001678.2-753s1c1
Sequence:CCGGCCTTACAACGACTCTATGCAACTCGAGTTGCATAGAGTCGTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001678.2-1178s1c1
Sequence:CCGGGAATGTAGAATGTCGCATCAACTCGAGTTGATGCGACATTCTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001678.2-935s1c1
Sequence:CCGGCTGTGTCTTCATCAAGATGAACTCGAGTTCATCTTGATGAAGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001678.2-674s1c1
Sequence:CCGGGAACCTTGATGTCATTGTCAACTCGAGTTGACAATGACATCAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001678.2-737s1c1
Sequence:CCGGCAACAAGTTCTTGGAGCCTTACTCGAGTAAGGCTCCAAGAACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001678
VALIDATED
ATP1B2 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, beta 2 polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001678.3-1354s21c1
Sequence:CCGGGAATGTAGAATGTCGCATCAACTCGAGTTGATGCGACATTCTACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001678.3-1843s21c1
Sequence:CCGGACGTGCACACGCGTCTCATTTCTCGAGAAATGAGACGCGTGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001678.3-1111s21c1
Sequence:CCGGCTGTGTCTTCATCAAGATGAACTCGAGTTCATCTTGATGAAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001678.3-984s21c1
Sequence:CCGGATTACGAACAGCCAGATAATGCTCGAGCATTATCTGGCTGTTCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001678.2-753s1c1
Sequence:CCGGCCTTACAACGACTCTATGCAACTCGAGTTGCATAGAGTCGTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001678.2-1178s1c1
Sequence:CCGGGAATGTAGAATGTCGCATCAACTCGAGTTGATGCGACATTCTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001678.2-935s1c1
Sequence:CCGGCTGTGTCTTCATCAAGATGAACTCGAGTTCATCTTGATGAAGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001678.2-674s1c1
Sequence:CCGGGAACCTTGATGTCATTGTCAACTCGAGTTGACAATGACATCAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001678.2-737s1c1
Sequence:CCGGCAACAAGTTCTTGGAGCCTTACTCGAGTAAGGCTCCAAGAACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001678
VALIDATED
ATP1B2 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, beta 2 polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001678.3-1354s21c1
Sequence:CCGGGAATGTAGAATGTCGCATCAACTCGAGTTGATGCGACATTCTACATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285366    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001678.3-1843s21c1
Sequence:CCGGACGTGCACACGCGTCTCATTTCTCGAGAAATGAGACGCGTGTGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001678.3-1111s21c1
Sequence:CCGGCTGTGTCTTCATCAAGATGAACTCGAGTTCATCTTGATGAAGACACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001678.3-984s21c1
Sequence:CCGGATTACGAACAGCCAGATAATGCTCGAGCATTATCTGGCTGTTCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149963    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001678.2-753s1c1
Sequence:CCGGCCTTACAACGACTCTATGCAACTCGAGTTGCATAGAGTCGTTGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001678.2-1178s1c1
Sequence:CCGGGAATGTAGAATGTCGCATCAACTCGAGTTGATGCGACATTCTACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001678.2-935s1c1
Sequence:CCGGCTGTGTCTTCATCAAGATGAACTCGAGTTCATCTTGATGAAGACACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001678.2-674s1c1
Sequence:CCGGGAACCTTGATGTCATTGTCAACTCGAGTTGACAATGACATCAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001678.2-737s1c1
Sequence:CCGGCAACAAGTTCTTGGAGCCTTACTCGAGTAAGGCTCCAAGAACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013415
ATP1B2 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, beta 2 polypeptide
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013415.2-1495s1c1
Sequence:CCGGCCACACAATTTCCAACATCTTCTCGAGAAGATGTTGGAAATTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013415.2-1130s1c1
Sequence:CCGGCTGATGTACTTTCCCTACTATCTCGAGATAGTAGGGAAAGTACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013415.2-1129s1c1
Sequence:CCGGTCTGATGTACTTTCCCTACTACTCGAGTAGTAGGGAAAGTACATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013415.2-854s1c1
Sequence:CCGGCGATATTATGAGCAACCTGATCTCGAGATCAGGTTGCTCATAATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013415.2-713s1c1
Sequence:CCGGCCCAAGACTGAGAACCTTGATCTCGAGATCAAGGTTCTCAGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013415
ATP1B2 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, beta 2 polypeptide
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013415.2-1495s1c1
Sequence:CCGGCCACACAATTTCCAACATCTTCTCGAGAAGATGTTGGAAATTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013415.2-1130s1c1
Sequence:CCGGCTGATGTACTTTCCCTACTATCTCGAGATAGTAGGGAAAGTACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013415.2-1129s1c1
Sequence:CCGGTCTGATGTACTTTCCCTACTACTCGAGTAGTAGGGAAAGTACATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013415.2-854s1c1
Sequence:CCGGCGATATTATGAGCAACCTGATCTCGAGATCAGGTTGCTCATAATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013415.2-713s1c1
Sequence:CCGGCCCAAGACTGAGAACCTTGATCTCGAGATCAAGGTTCTCAGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013415
ATP1B2 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, beta 2 polypeptide
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013415.2-1495s1c1
Sequence:CCGGCCACACAATTTCCAACATCTTCTCGAGAAGATGTTGGAAATTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013415.2-1130s1c1
Sequence:CCGGCTGATGTACTTTCCCTACTATCTCGAGATAGTAGGGAAAGTACATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013415.2-1129s1c1
Sequence:CCGGTCTGATGTACTTTCCCTACTACTCGAGTAGTAGGGAAAGTACATCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013415.2-854s1c1
Sequence:CCGGCGATATTATGAGCAACCTGATCTCGAGATCAGGTTGCTCATAATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013415.2-713s1c1
Sequence:CCGGCCCAAGACTGAGAACCTTGATCTCGAGATCAAGGTTCTCAGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks