EMAIL THIS PAGE TO A FRIEND

ATP1B3

ATPase, Na+/K+ transporting, beta 3 polypeptide

108 Gene Product Result for
Synonyms: ATPB-3 CD298
UniProtKB ID: P54709
Gene ID:
Human(483) Summary: The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 3 subunit. This gene encodes a beta 3 subunit. A pseudogene exists for this gene, and it is located on chromosome 2. [provided by RefSeq, Jul 2008]
Mouse(11933) ATPase, Na+/K+ transporting, beta 3 polypeptide
Rat(25390) ATPase, Na+/K+ transporting, beta 3 polypeptide
chicken(396549) ATPase, Na+/K+ transporting, beta 3 polypeptide
dog(477098) ATPase, Na+/K+ transporting, beta 3 polypeptide
domestic cat(101097586) ATPase, Na+/K+ transporting, beta 3 polypeptide
Horse(100062895) ATPase, Na+/K+ transporting, beta 3 polypeptide
cow(532844) ATPase, Na+/K+ transporting, beta 3 polypeptide
Domestic Rabbit(100008788) ATPase, Na+/K+ transporting, beta 3 polypeptide
naked mole-rat(101697891) ATPase, Na+/K+ transporting, beta 3 polypeptide
domestic guinea pig(100135484) ATPase, Na+/K+ transporting, beta 3 polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001679 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001679 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001679 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001679 Rosetta Predictions human pricing
NM_012913 Rosetta Predictions rat pricing
NM_007502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001679 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069463 predicted 923
2 SASI_Hs02_00332327 predicted 739
3 SASI_Hs01_00069465 predicted 742
4 SASI_Hs01_00069466 predicted 332
5 SASI_Hs02_00332328 predicted 584
6 SASI_Hs01_00069467 predicted 344
7 SASI_Hs01_00069469 predicted 594
8 SASI_Hs01_00069471 predicted 478
9 SASI_Hs02_00332329 predicted 847
10 SASI_Hs02_00332330 predicted 856
11 SASI_Hs01_00069462 predicted 641
12 SASI_Hs01_00069464 predicted 285
13 SASI_Hs01_00069468 predicted 1028
14 SASI_Hs01_00069470 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012913 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260448 predicted 952
2 SASI_Rn01_00095261 predicted 423
3 SASI_Rn01_00095262 predicted 954
4 SASI_Rn01_00095263 predicted 883
5 SASI_Rn01_00095264 predicted 832
6 SASI_Rn01_00095265 predicted 551
7 SASI_Rn02_00260449 predicted 750
8 SASI_Rn01_00095266 predicted 607
9 SASI_Rn01_00095267 predicted 759
10 SASI_Rn01_00095268 predicted 893
11 SASI_Rn01_00095269 predicted 939
12 SASI_Rn01_00095270 predicted 1015
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311780 predicted 248
2 SASI_Mm01_00124762 predicted 824
3 SASI_Mm01_00124763 predicted 555
4 SASI_Mm01_00124764 predicted 999
5 SASI_Mm01_00124765 predicted 975
6 SASI_Mm01_00124766 predicted 875
7 SASI_Mm01_00124767 predicted 338
8 SASI_Mm01_00124768 predicted 679
9 SASI_Mm01_00124770 predicted 309
10 SASI_Mm02_00311781 predicted 843
11 SASI_Mm01_00124769 predicted 565
12 SASI_Mm01_00124771 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007502
VALIDATED
ATP1B3 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, beta 3 polypeptide
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007502.1-649s1c1
Sequence:CCGGACAGCCTTGCATCCTTGTGAACTCGAGTTCACAAGGATGCAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007502.1-938s1c1
Sequence:CCGGGACAAGTTCTTGGGACGTGTTCTCGAGAACACGTCCCAAGAACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007502.1-1245s1c1
Sequence:CCGGCCTGTCTTCTTTGTGTGTAATCTCGAGATTACACACAAAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007502.1-695s1c1
Sequence:CCGGCCAGACGGATATCCACAAATACTCGAGTATTTGTGGATATCCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007502.1-356s1c1
Sequence:CCGGCCGAAATATCGAGACCAGATTCTCGAGAATCTGGTCTCGATATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007502.4-646s21c1
Sequence:CCGGACAGCCTTGCATCCTTGTGAACTCGAGTTCACAAGGATGCAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007502.4-1242s21c1
Sequence:CCGGCCTGTCTTCTTTGTGTGTAATCTCGAGATTACACACAAAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007502.4-353s21c1
Sequence:CCGGCCGAAATATCGAGACCAGATTCTCGAGAATCTGGTCTCGATATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007502.4-935s21c1
Sequence:CCGGGACAAGTTCTTGGGACGTGTTCTCGAGAACACGTCCCAAGAACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007502
VALIDATED
ATP1B3 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, beta 3 polypeptide
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007502.1-649s1c1
Sequence:CCGGACAGCCTTGCATCCTTGTGAACTCGAGTTCACAAGGATGCAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007502.1-938s1c1
Sequence:CCGGGACAAGTTCTTGGGACGTGTTCTCGAGAACACGTCCCAAGAACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007502.1-1245s1c1
Sequence:CCGGCCTGTCTTCTTTGTGTGTAATCTCGAGATTACACACAAAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007502.1-695s1c1
Sequence:CCGGCCAGACGGATATCCACAAATACTCGAGTATTTGTGGATATCCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007502.1-356s1c1
Sequence:CCGGCCGAAATATCGAGACCAGATTCTCGAGAATCTGGTCTCGATATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007502.4-646s21c1
Sequence:CCGGACAGCCTTGCATCCTTGTGAACTCGAGTTCACAAGGATGCAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007502.4-1242s21c1
Sequence:CCGGCCTGTCTTCTTTGTGTGTAATCTCGAGATTACACACAAAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007502.4-353s21c1
Sequence:CCGGCCGAAATATCGAGACCAGATTCTCGAGAATCTGGTCTCGATATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007502.4-935s21c1
Sequence:CCGGGACAAGTTCTTGGGACGTGTTCTCGAGAACACGTCCCAAGAACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007502
VALIDATED
ATP1B3 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, beta 3 polypeptide
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007502.1-649s1c1
Sequence:CCGGACAGCCTTGCATCCTTGTGAACTCGAGTTCACAAGGATGCAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007502.1-938s1c1
Sequence:CCGGGACAAGTTCTTGGGACGTGTTCTCGAGAACACGTCCCAAGAACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112820    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007502.1-1245s1c1
Sequence:CCGGCCTGTCTTCTTTGTGTGTAATCTCGAGATTACACACAAAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007502.1-695s1c1
Sequence:CCGGCCAGACGGATATCCACAAATACTCGAGTATTTGTGGATATCCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007502.1-356s1c1
Sequence:CCGGCCGAAATATCGAGACCAGATTCTCGAGAATCTGGTCTCGATATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324201    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007502.4-646s21c1
Sequence:CCGGACAGCCTTGCATCCTTGTGAACTCGAGTTCACAAGGATGCAAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007502.4-1242s21c1
Sequence:CCGGCCTGTCTTCTTTGTGTGTAATCTCGAGATTACACACAAAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007502.4-353s21c1
Sequence:CCGGCCGAAATATCGAGACCAGATTCTCGAGAATCTGGTCTCGATATTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007502.4-935s21c1
Sequence:CCGGGACAAGTTCTTGGGACGTGTTCTCGAGAACACGTCCCAAGAACTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001679
ATP1B3 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, beta 3 polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001679.1-1239s1c1
Sequence:CCGGGCCAACATCAAGTGACTTTATCTCGAGATAAAGTCACTTGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001679.1-428s1c1
Sequence:CCGGCATGTCAGTTTCCTATTTCATCTCGAGATGAAATAGGAAACTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001679.1-715s1c1
Sequence:CCGGCCTAACAACACTGGGAAAGAACTCGAGTTCTTTCCCAGTGTTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001679.1-187s1c1
Sequence:CCGGCAGACTCTCAACGATGAGGTTCTCGAGAACCTCATCGTTGAGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001679.1-310s1c1
Sequence:CCGGGCAGGGTACATTGAAGACCTTCTCGAGAAGGTCTTCAATGTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001679.2-1009s21c1
Sequence:CCGGGCATAGTATGAGTAGGATATCCTCGAGGATATCCTACTCATACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001679.2-576s21c1
Sequence:CCGGTGAACAGAAGGGTCCAGTTTACTCGAGTAAACTGGACCCTTCTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001679.2-930s21c1
Sequence:CCGGTGATGGATCAGCCAACCTAAACTCGAGTTTAGGTTGGCTGATCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001679.2-1129s21c1
Sequence:CCGGTGACATTGGGTTACATCATAACTCGAGTTATGATGTAACCCAATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001679
ATP1B3 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, beta 3 polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001679.1-1239s1c1
Sequence:CCGGGCCAACATCAAGTGACTTTATCTCGAGATAAAGTCACTTGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001679.1-428s1c1
Sequence:CCGGCATGTCAGTTTCCTATTTCATCTCGAGATGAAATAGGAAACTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001679.1-715s1c1
Sequence:CCGGCCTAACAACACTGGGAAAGAACTCGAGTTCTTTCCCAGTGTTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001679.1-187s1c1
Sequence:CCGGCAGACTCTCAACGATGAGGTTCTCGAGAACCTCATCGTTGAGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001679.1-310s1c1
Sequence:CCGGGCAGGGTACATTGAAGACCTTCTCGAGAAGGTCTTCAATGTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001679.2-1009s21c1
Sequence:CCGGGCATAGTATGAGTAGGATATCCTCGAGGATATCCTACTCATACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001679.2-576s21c1
Sequence:CCGGTGAACAGAAGGGTCCAGTTTACTCGAGTAAACTGGACCCTTCTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001679.2-930s21c1
Sequence:CCGGTGATGGATCAGCCAACCTAAACTCGAGTTTAGGTTGGCTGATCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001679.2-1129s21c1
Sequence:CCGGTGACATTGGGTTACATCATAACTCGAGTTATGATGTAACCCAATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001679
ATP1B3 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, beta 3 polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001679.1-1239s1c1
Sequence:CCGGGCCAACATCAAGTGACTTTATCTCGAGATAAAGTCACTTGATGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001679.1-428s1c1
Sequence:CCGGCATGTCAGTTTCCTATTTCATCTCGAGATGAAATAGGAAACTGACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001679.1-715s1c1
Sequence:CCGGCCTAACAACACTGGGAAAGAACTCGAGTTCTTTCCCAGTGTTGTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001679.1-187s1c1
Sequence:CCGGCAGACTCTCAACGATGAGGTTCTCGAGAACCTCATCGTTGAGAGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001679.1-310s1c1
Sequence:CCGGGCAGGGTACATTGAAGACCTTCTCGAGAAGGTCTTCAATGTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001679.2-1009s21c1
Sequence:CCGGGCATAGTATGAGTAGGATATCCTCGAGGATATCCTACTCATACTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001679.2-576s21c1
Sequence:CCGGTGAACAGAAGGGTCCAGTTTACTCGAGTAAACTGGACCCTTCTGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422619    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001679.2-930s21c1
Sequence:CCGGTGATGGATCAGCCAACCTAAACTCGAGTTTAGGTTGGCTGATCCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425916    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001679.2-1129s21c1
Sequence:CCGGTGACATTGGGTTACATCATAACTCGAGTTATGATGTAACCCAATGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks