EMAIL THIS PAGE TO A FRIEND

ATP1B4

ATPase, Na+/K+ transporting, beta 4 polypeptide

65 Gene Product Result for
UniProtKB ID: Q9UN42, Q17RR0, Q9UN41
Gene ID:
Human(23439) Summary: This gene has been found in all vertebrate genomes sequenced to date. However, this gene has undergone a change in function in placental mammals compared to other species. Specifically, in fish, avian, and amphibian species, this gene encodes plasma membrane-bound beta-subunits of Na,K-ATPase. In placental mammals, the encoded protein interacts with the nuclear transcriptional coregulator SKIP and may be involved in the regulation of TGF-beta signaling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(67821) ATPase, (Na+)/K+ transporting, beta 4 polypeptide
Rat(84396) ATPase, (Na+)/K+ transporting, beta 4 polypeptide
Zebrafish(100037383) ATPase, (Na+)/K+ transporting, beta 4 polypeptide
cow(510026) ATPase, Na+/K+ transporting, beta 4 polypeptide
domestic cat(101087210) ATPase, Na+/K+ transporting, beta 4 polypeptide
chicken(422365) ATPase, Na+/K+ transporting, beta 4 polypeptide
dog(481036) ATPase, Na+/K+ transporting, beta 4 polypeptide
naked mole-rat(101709990) ATPase, Na+/K+ transporting, beta 4 polypeptide
domestic guinea pig(100713904) ATPase, Na+/K+ transporting, beta 4 polypeptide
sheep(101113044) ATPase, Na+/K+ transporting, beta 4 polypeptide
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2105681 Anti-ATP1B4 antibody produced in rabbit affinity isolated antibody human, horse, guinea pig, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133690 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133690 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133690 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012069 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012069 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012069 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU141281 MISSION® esiRNA esiRNA human ATP1B4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012069 Rosetta Predictions human pricing
NM_053381 Rosetta Predictions rat pricing
NM_133690 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012069 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143669 predicted 567
2 SASI_Hs01_00143670 predicted 597
3 SASI_Hs01_00143671 predicted 574
4 SASI_Hs01_00143672 predicted 571
5 SASI_Hs01_00143673 predicted 688
6 SASI_Hs02_00343536 predicted 1044
7 SASI_Hs01_00143674 predicted 495
8 SASI_Hs01_00143675 predicted 934
9 SASI_Hs02_00343537 predicted 480
10 SASI_Hs01_00143676 predicted 810
11 SASI_Hs01_00143667 predicted 610
12 SASI_Hs01_00143668 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053381 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084708 predicted 555
2 SASI_Rn01_00084709 predicted 802
3 SASI_Rn01_00084710 predicted 525
4 SASI_Rn01_00084711 predicted 603
5 SASI_Rn01_00084712 predicted 583
6 SASI_Rn01_00084713 predicted 517
7 SASI_Rn01_00084714 predicted 837
8 SASI_Rn01_00084715 predicted 1185
9 SASI_Rn01_00084716 predicted 828
10 SASI_Rn01_00084717 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133690 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00199197 predicted 478
2 SASI_Mm01_00199198 predicted 729
3 SASI_Mm01_00199199 predicted 449
4 SASI_Mm01_00199200 predicted 551
5 SASI_Mm01_00199201 predicted 825
6 SASI_Mm01_00199202 predicted 438
7 SASI_Mm01_00199203 predicted 504
8 SASI_Mm01_00199204 predicted 965
9 SASI_Mm02_00338650 predicted 466
10 SASI_Mm01_00199206 predicted 490
11 SASI_Mm01_00199205 predicted 581
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133690
ATP1B4 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, beta 4 polypeptide
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133690.2-992s21c1
Sequence:CCGGAGGGCAAAGGCATCGTAAATGCTCGAGCATTTACGATGCCTTTGCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133690.2-645s21c1
Sequence:CCGGCAAGAAGGCCTGCCAATTTAACTCGAGTTAAATTGGCAGGCCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133690.1-3226s1c1
Sequence:CCGGCCGGAGTTACTTTCTCACAAACTCGAGTTTGTGAGAAAGTAACTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133690.1-247s1c1
Sequence:CCGGCGGAAATTGCAGATCGTGAATCTCGAGATTCACGATCTGCAATTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133690.1-76s1c1
Sequence:CCGGGAAGCGAATCACAACTACTTACTCGAGTAAGTAGTTGTGATTCGCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133690.1-402s1c1
Sequence:CCGGCCTAGCCATCAGTCCTTACATCTCGAGATGTAAGGACTGATGGCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133690.1-526s1c1
Sequence:CCGGCGTTACGTGATTAGCCTAAATCTCGAGATTTAGGCTAATCACGTAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133690
ATP1B4 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, beta 4 polypeptide
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133690.2-992s21c1
Sequence:CCGGAGGGCAAAGGCATCGTAAATGCTCGAGCATTTACGATGCCTTTGCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133690.2-645s21c1
Sequence:CCGGCAAGAAGGCCTGCCAATTTAACTCGAGTTAAATTGGCAGGCCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133690.1-3226s1c1
Sequence:CCGGCCGGAGTTACTTTCTCACAAACTCGAGTTTGTGAGAAAGTAACTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133690.1-247s1c1
Sequence:CCGGCGGAAATTGCAGATCGTGAATCTCGAGATTCACGATCTGCAATTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133690.1-76s1c1
Sequence:CCGGGAAGCGAATCACAACTACTTACTCGAGTAAGTAGTTGTGATTCGCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133690.1-402s1c1
Sequence:CCGGCCTAGCCATCAGTCCTTACATCTCGAGATGTAAGGACTGATGGCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133690.1-526s1c1
Sequence:CCGGCGTTACGTGATTAGCCTAAATCTCGAGATTTAGGCTAATCACGTAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133690
ATP1B4 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, beta 4 polypeptide
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133690.2-992s21c1
Sequence:CCGGAGGGCAAAGGCATCGTAAATGCTCGAGCATTTACGATGCCTTTGCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133690.2-645s21c1
Sequence:CCGGCAAGAAGGCCTGCCAATTTAACTCGAGTTAAATTGGCAGGCCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079903    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133690.1-3226s1c1
Sequence:CCGGCCGGAGTTACTTTCTCACAAACTCGAGTTTGTGAGAAAGTAACTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133690.1-247s1c1
Sequence:CCGGCGGAAATTGCAGATCGTGAATCTCGAGATTCACGATCTGCAATTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133690.1-76s1c1
Sequence:CCGGGAAGCGAATCACAACTACTTACTCGAGTAAGTAGTTGTGATTCGCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133690.1-402s1c1
Sequence:CCGGCCTAGCCATCAGTCCTTACATCTCGAGATGTAAGGACTGATGGCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133690.1-526s1c1
Sequence:CCGGCGTTACGTGATTAGCCTAAATCTCGAGATTTAGGCTAATCACGTAACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012069
ATP1B4 MISSION shRNA Bacterial Glycerol Stock
ATPase, Na+/K+ transporting, beta 4 polypeptide
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012069.4-622s21c1
Sequence:CCGGGGCTTTCTCCAGGGTTATAATCTCGAGATTATAACCCTGGAGAAAGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012069.4-1064s21c1
Sequence:CCGGTGAAGGGCAAAGGCGTCATAACTCGAGTTATGACGCCTTTGCCCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012069.4-1410s21c1
Sequence:CCGGGTAATCTCCCTGTAGCGTAAACTCGAGTTTACGCTACAGGGAGATTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-987s1c1
Sequence:CCGGGCACTTTACAGACGTGGTGAACTCGAGTTCACCACGTCTGTAAAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-786s1c1
Sequence:CCGGCCTTCTAAAGATGAACCGGATCTCGAGATCCGGTTCATCTTTAGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-1090s1c1
Sequence:CCGGGTAATCTTTACCCTGAACATACTCGAGTATGTTCAGGGTAAAGATTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-88s1c1
Sequence:CCGGCCATCCTTTCCTTACAGTTATCTCGAGATAACTGTAAGGAAAGGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-573s1c1
Sequence:CCGGGCATTATGTGATTAGCCTAAACTCGAGTTTAGGCTAATCACATAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012069
ATP1B4 MISSION shRNA shRNA Plasmid DNA
ATPase, Na+/K+ transporting, beta 4 polypeptide
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012069.4-622s21c1
Sequence:CCGGGGCTTTCTCCAGGGTTATAATCTCGAGATTATAACCCTGGAGAAAGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012069.4-1064s21c1
Sequence:CCGGTGAAGGGCAAAGGCGTCATAACTCGAGTTATGACGCCTTTGCCCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000434775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012069.4-1410s21c1
Sequence:CCGGGTAATCTCCCTGTAGCGTAAACTCGAGTTTACGCTACAGGGAGATTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-987s1c1
Sequence:CCGGGCACTTTACAGACGTGGTGAACTCGAGTTCACCACGTCTGTAAAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-786s1c1
Sequence:CCGGCCTTCTAAAGATGAACCGGATCTCGAGATCCGGTTCATCTTTAGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-1090s1c1
Sequence:CCGGGTAATCTTTACCCTGAACATACTCGAGTATGTTCAGGGTAAAGATTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-88s1c1
Sequence:CCGGCCATCCTTTCCTTACAGTTATCTCGAGATAACTGTAAGGAAAGGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000042849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-573s1c1
Sequence:CCGGGCATTATGTGATTAGCCTAAACTCGAGTTTAGGCTAATCACATAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012069
ATP1B4 MISSION shRNA Lentiviral Transduction Particles
ATPase, Na+/K+ transporting, beta 4 polypeptide
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421593    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012069.4-622s21c1
Sequence:CCGGGGCTTTCTCCAGGGTTATAATCTCGAGATTATAACCCTGGAGAAAGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012069.4-1064s21c1
Sequence:CCGGTGAAGGGCAAAGGCGTCATAACTCGAGTTATGACGCCTTTGCCCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000434775    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012069.4-1410s21c1
Sequence:CCGGGTAATCTCCCTGTAGCGTAAACTCGAGTTTACGCTACAGGGAGATTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-987s1c1
Sequence:CCGGGCACTTTACAGACGTGGTGAACTCGAGTTCACCACGTCTGTAAAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-786s1c1
Sequence:CCGGCCTTCTAAAGATGAACCGGATCTCGAGATCCGGTTCATCTTTAGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-1090s1c1
Sequence:CCGGGTAATCTTTACCCTGAACATACTCGAGTATGTTCAGGGTAAAGATTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042850    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-88s1c1
Sequence:CCGGCCATCCTTTCCTTACAGTTATCTCGAGATAACTGTAAGGAAAGGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000042849    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012069.2-573s1c1
Sequence:CCGGGCATTATGTGATTAGCCTAAACTCGAGTTTAGGCTAATCACATAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)