EMAIL THIS PAGE TO A FRIEND

ATP2A1

ATPase, Ca++ transporting, cardiac muscle, fast twitch 1

73 Gene Product Result for
Synonyms: ATP2A SERCA1
UniProtKB ID: O14983, A8K5J9, O14984
Gene ID:
Human(487) Summary: This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in muscular excitation and contraction. Mutations in this gene cause some autosomal recessive forms of Brody disease, characterized by increasing impairment of muscular relaxation during exercise. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(11937) ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Rat(116601) ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
sheep(101111766) ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Domestic Rabbit(100037716) ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
domestic guinea pig(100726234) ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
naked mole-rat(101716306) ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Zebrafish(260440) ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
cow(518117) ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Horse(100064403) ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
chicken(396528) ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
dog(479797) ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
domestic cat(101091492) ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007504 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007504 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007504 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004320 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004320 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004320 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU064591 MISSION® esiRNA esiRNA human ATP2A1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004320 Rosetta Predictions human pricing
NM_173201 Rosetta Predictions human pricing
NM_058213 Rosetta Predictions rat pricing
NM_007504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004320 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069924 predicted 1059
2 SASI_Hs01_00069925 predicted 1655
3 SASI_Hs02_00337358 predicted 466
4 SASI_Hs01_00069926 predicted 209
5 SASI_Hs01_00069927 predicted 1538
6 SASI_Hs01_00069928 predicted 1337
7 SASI_Hs01_00069929 predicted 451
8 SASI_Hs01_00069930 predicted 1051
9 SASI_Hs01_00069931 predicted 1751
10 SASI_Hs01_00069932 predicted 991
11 SASI_Hs01_00069933 predicted 2916
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173201 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121216 predicted 1055
2 SASI_Hs01_00121217 predicted 1647
3 SASI_Hs02_00368157 predicted 458
4 SASI_Hs01_00121218 predicted 207
5 SASI_Hs01_00121219 predicted 1540
6 SASI_Hs01_00121220 predicted 1338
7 SASI_Hs01_00121221 predicted 454
8 SASI_Hs01_00121222 predicted 1057
9 SASI_Hs01_00121223 predicted 1752
10 SASI_Hs01_00121224 predicted 997
11 SASI_Hs01_00121225 predicted 2919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086255 predicted 548
2 SASI_Rn01_00086256 predicted 977
3 SASI_Rn01_00086257 predicted 1906
4 SASI_Rn01_00086258 predicted 1600
5 SASI_Rn01_00086259 predicted 1733
6 SASI_Rn01_00086260 predicted 1732
7 SASI_Rn01_00086261 predicted 2900
8 SASI_Rn02_00267186 predicted 1290
9 SASI_Rn01_00086262 predicted 1880
10 SASI_Rn01_00086263 predicted 1719
11 SASI_Rn01_00086264 predicted 1553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085921 predicted 1232
2 SASI_Mm01_00085922 predicted 1554
3 SASI_Mm02_00311785 predicted 2851
4 SASI_Mm01_00085924 predicted 1889
5 SASI_Mm01_00085925 predicted 962
6 SASI_Mm01_00085926 predicted 1586
7 SASI_Mm01_00085927 predicted 3111
8 SASI_Mm01_00085928 predicted 1714
9 SASI_Mm01_00085930 predicted 1277
10 SASI_Mm02_00311786 predicted 1223
11 SASI_Mm01_00085923 predicted 2682
12 SASI_Mm01_00085929 predicted 2754
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007504
ATP2A1 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007504.2-3171s1c1
Sequence:CCGGCAGATCCAGAAGACGAAAGAACTCGAGTTCTTTCGTCTTCTGGATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007504.2-2192s1c1
Sequence:CCGGCCCTCACACAAGTCCAAGATTCTCGAGAATCTTGGACTTGTGTGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007504.2-227s1c1
Sequence:CCGGCCAGACCAAGTTAAGCGACATCTCGAGATGTCGCTTAACTTGGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007504.2-2872s1c1
Sequence:CCGGCGAGATGTGCAATGCTCTCAACTCGAGTTGAGAGCATTGCACATCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007504.2-3103s1c1
Sequence:CCGGCAAGTTCATTGCTCGGAACTACTCGAGTAGTTCCGAGCAATGAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007504.2-492s21c1
Sequence:CCGGACGCTATCGAAGCGCTGAAAGCTCGAGCTTTCAGCGCTTCGATAGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007504.2-2049s21c1
Sequence:CCGGTTGCCATCTGCCGACGAATTGCTCGAGCAATTCGTCGGCAGATGGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007504.2-1413s21c1
Sequence:CCGGATGATTCCTCCTTGGACTTTACTCGAGTAAAGTCCAAGGAGGAATCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007504
ATP2A1 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007504.2-3171s1c1
Sequence:CCGGCAGATCCAGAAGACGAAAGAACTCGAGTTCTTTCGTCTTCTGGATCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007504.2-2192s1c1
Sequence:CCGGCCCTCACACAAGTCCAAGATTCTCGAGAATCTTGGACTTGTGTGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007504.2-227s1c1
Sequence:CCGGCCAGACCAAGTTAAGCGACATCTCGAGATGTCGCTTAACTTGGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007504.2-2872s1c1
Sequence:CCGGCGAGATGTGCAATGCTCTCAACTCGAGTTGAGAGCATTGCACATCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007504.2-3103s1c1
Sequence:CCGGCAAGTTCATTGCTCGGAACTACTCGAGTAGTTCCGAGCAATGAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007504.2-492s21c1
Sequence:CCGGACGCTATCGAAGCGCTGAAAGCTCGAGCTTTCAGCGCTTCGATAGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000414172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007504.2-2049s21c1
Sequence:CCGGTTGCCATCTGCCGACGAATTGCTCGAGCAATTCGTCGGCAGATGGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007504.2-1413s21c1
Sequence:CCGGATGATTCCTCCTTGGACTTTACTCGAGTAAAGTCCAAGGAGGAATCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007504
ATP2A1 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101755    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007504.2-3171s1c1
Sequence:CCGGCAGATCCAGAAGACGAAAGAACTCGAGTTCTTTCGTCTTCTGGATCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007504.2-2192s1c1
Sequence:CCGGCCCTCACACAAGTCCAAGATTCTCGAGAATCTTGGACTTGTGTGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007504.2-227s1c1
Sequence:CCGGCCAGACCAAGTTAAGCGACATCTCGAGATGTCGCTTAACTTGGTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101758    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007504.2-2872s1c1
Sequence:CCGGCGAGATGTGCAATGCTCTCAACTCGAGTTGAGAGCATTGCACATCTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007504.2-3103s1c1
Sequence:CCGGCAAGTTCATTGCTCGGAACTACTCGAGTAGTTCCGAGCAATGAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007504.2-492s21c1
Sequence:CCGGACGCTATCGAAGCGCTGAAAGCTCGAGCTTTCAGCGCTTCGATAGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000414172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007504.2-2049s21c1
Sequence:CCGGTTGCCATCTGCCGACGAATTGCTCGAGCAATTCGTCGGCAGATGGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007504.2-1413s21c1
Sequence:CCGGATGATTCCTCCTTGGACTTTACTCGAGTAAAGTCCAAGGAGGAATCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004320
ATP2A1 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-1540s1c1
Sequence:CCGGCCAGCTAATGAAGAAGGAATTCTCGAGAATTCCTTCTTCATTAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-188s1c1
Sequence:CCGGCCGGACCAAGTTAAGCGGAATCTCGAGATTCCGCTTAACTTGGTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-1682s1c1
Sequence:CCGGCGCTGTAACTATGTGCGAGTTCTCGAGAACTCGCACATAGTTACAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-986s1c1
Sequence:CCGGGCCATCTACTACTTTAAGATTCTCGAGAATCTTAAAGTAGTAGATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-658s1c1
Sequence:CCGGCGAGTCTGTATCTGTCATCAACTCGAGTTGATGACAGATACAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004320.3-2825s21c1
Sequence:CCGGACCCACTTTGAGGGCATAGACCTCGAGGTCTATGCCCTCAAAGTGGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004320.3-3151s21c1
Sequence:CCGGGAACTACCTAGAGGGATAACTCTCGAGAGTTATCCCTCTAGGTAGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004320.3-3113s21c1
Sequence:CCGGGTCATTGGGCTCGACGAAATCCTCGAGGATTTCGTCGAGCCCAATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004320
ATP2A1 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-1540s1c1
Sequence:CCGGCCAGCTAATGAAGAAGGAATTCTCGAGAATTCCTTCTTCATTAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-188s1c1
Sequence:CCGGCCGGACCAAGTTAAGCGGAATCTCGAGATTCCGCTTAACTTGGTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-1682s1c1
Sequence:CCGGCGCTGTAACTATGTGCGAGTTCTCGAGAACTCGCACATAGTTACAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-986s1c1
Sequence:CCGGGCCATCTACTACTTTAAGATTCTCGAGAATCTTAAAGTAGTAGATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-658s1c1
Sequence:CCGGCGAGTCTGTATCTGTCATCAACTCGAGTTGATGACAGATACAGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004320.3-2825s21c1
Sequence:CCGGACCCACTTTGAGGGCATAGACCTCGAGGTCTATGCCCTCAAAGTGGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004320.3-3151s21c1
Sequence:CCGGGAACTACCTAGAGGGATAACTCTCGAGAGTTATCCCTCTAGGTAGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004320.3-3113s21c1
Sequence:CCGGGTCATTGGGCTCGACGAAATCCTCGAGGATTTCGTCGAGCCCAATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004320
ATP2A1 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, cardiac muscle, fast twitch 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-1540s1c1
Sequence:CCGGCCAGCTAATGAAGAAGGAATTCTCGAGAATTCCTTCTTCATTAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-188s1c1
Sequence:CCGGCCGGACCAAGTTAAGCGGAATCTCGAGATTCCGCTTAACTTGGTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-1682s1c1
Sequence:CCGGCGCTGTAACTATGTGCGAGTTCTCGAGAACTCGCACATAGTTACAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-986s1c1
Sequence:CCGGGCCATCTACTACTTTAAGATTCTCGAGAATCTTAAAGTAGTAGATGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004320.2-658s1c1
Sequence:CCGGCGAGTCTGTATCTGTCATCAACTCGAGTTGATGACAGATACAGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004320.3-2825s21c1
Sequence:CCGGACCCACTTTGAGGGCATAGACCTCGAGGTCTATGCCCTCAAAGTGGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422065    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004320.3-3151s21c1
Sequence:CCGGGAACTACCTAGAGGGATAACTCTCGAGAGTTATCCCTCTAGGTAGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004320.3-3113s21c1
Sequence:CCGGGTCATTGGGCTCGACGAAATCCTCGAGGATTTCGTCGAGCCCAATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)