EMAIL THIS PAGE TO A FRIEND

ATP2A2

ATPase, Ca++ transporting, cardiac muscle, slow twitch 2

212 Gene Product Result for
Synonyms: ATP2B DAR DD SERCA2
UniProtKB ID: P16615, A6NDN7, B4DF05, P16614, Q86VJ2
Gene ID:
Human(488) Summary: This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol into the sarcoplasmic reticulum lumen, and is involved in regulation of the contraction/relaxation cycle. Mutations in this gene cause Darier-White disease, also known as keratosis follicularis, an autosomal dominant skin disorder characterized by loss of adhesion between epidermal cells and abnormal keratinization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2008]
Mouse(11938) ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Rat(29693) ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
chicken(396446) ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
domestic cat(493691) ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
cow(540568) ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Horse(791242) ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
dog(403878) ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
naked mole-rat(101720630) ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
domestic guinea pig(100174978) ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
sheep(101104344) ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Domestic Rabbit(100038308) ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
sheep(100526801) ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108649 Anti-ATP2A2 affinity isolated antibody rabbit, pig, rat, canine, canine, horse, bovine, guinea pig, zebrafish, mouse
immunohistochemistry, western blot pricing
SAB2100180 Anti-ATP2A2 antibody produced in rabbit affinity isolated antibody human, rabbit, mouse, guinea pig, canine, horse, rat, pig
western blot pricing
HPA062605 Anti-ATP2A2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA067892 Anti-ATP2A2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
S1314 Monoclonal Anti-SERCa2 ATPase antibody produced in mouse clone 2A7-A1, ascites fluid rat, mouse, guinea pig, rabbit, canine, human
immunoprecipitation, western blot pricing
S1439 Monoclonal Anti-SERCa2 ATPase antibody produced in mouse clone IID8 pig, human, canine, rabbit, bovine, rat
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0741 AQUA Peptide EWGSGSDTL[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009722 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009722 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009722 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001681 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001681 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001681 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001681 Rosetta Predictions human pricing
NM_170665 Rosetta Predictions human pricing
NM_001110139 Rosetta Predictions rat pricing
NM_001110823 Rosetta Predictions rat pricing
NM_017290 Rosetta Predictions rat pricing
NM_001110140 Rosetta Predictions mouse pricing
NM_009722 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001681 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047711 predicted 2159
2 SASI_Hs01_00047712 predicted 1722
3 SASI_Hs01_00047713 predicted 1694
4 SASI_Hs02_00332331 predicted 2173
5 SASI_Hs01_00047714 predicted 1356
6 SASI_Hs01_00047715 predicted 1035
7 SASI_Hs01_00047716 predicted 1609
8 SASI_Hs01_00047717 predicted 1928
9 SASI_Hs01_00047718 predicted 1774
10 SASI_Hs01_00047719 predicted 809
11 SASI_Hs01_00047710 predicted 868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170665 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184963 predicted 2160
2 SASI_Hs01_00184964 predicted 1731
3 SASI_Hs01_00184965 predicted 1697
4 SASI_Hs02_00367574 predicted 2177
5 SASI_Hs01_00184966 predicted 1353
6 SASI_Hs01_00184967 predicted 1035
7 SASI_Hs01_00184968 predicted 1610
8 SASI_Hs01_00184969 predicted 1932
9 SASI_Hs01_00184970 predicted 1775
10 SASI_Hs01_00184971 predicted 812
11 SASI_Hs01_00184962 predicted 873
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110139 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251032 predicted 3099
2 SASI_Rn02_00251033 predicted 1049
3 SASI_Rn02_00251034 predicted 1016
4 SASI_Rn02_00251035 predicted 2509
5 SASI_Rn02_00251036 predicted 1701
6 SASI_Rn02_00251037 predicted 3205
7 SASI_Rn02_00251038 predicted 1636
8 SASI_Rn02_00251039 predicted 1657
9 SASI_Rn02_00251040 predicted 2871
10 SASI_Rn02_00251041 predicted 1006
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251382 predicted 3093
2 SASI_Rn02_00251383 predicted 1044
3 SASI_Rn02_00251384 predicted 1015
4 SASI_Rn02_00251385 predicted 2511
5 SASI_Rn02_00251386 predicted 1701
6 SASI_Rn02_00251387 predicted 3201
7 SASI_Rn02_00251388 predicted 1638
8 SASI_Rn02_00251389 predicted 1660
9 SASI_Rn02_00251390 predicted 2866
10 SASI_Rn02_00251391 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017290 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101323 predicted 3094
2 SASI_Rn01_00101324 predicted 1050
3 SASI_Rn01_00101325 predicted 1017
4 SASI_Rn01_00101326 predicted 2509
5 SASI_Rn02_00261729 predicted 1705
6 SASI_Rn01_00101328 predicted 3198
7 SASI_Rn01_00101329 predicted 1638
8 SASI_Rn01_00101330 predicted 1653
9 SASI_Rn01_00101331 predicted 2867
10 SASI_Rn01_00101332 predicted 1006
11 SASI_Rn01_00101327 predicted 1944
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304696 predicted 1083
2 SASI_Mm02_00304697 predicted 813
3 SASI_Mm02_00304698 predicted 1569
4 SASI_Mm02_00304699 predicted 1737
5 SASI_Mm02_00304700 predicted 2277
6 SASI_Mm02_00304701 predicted 2536
7 SASI_Mm02_00304702 predicted 2144
8 SASI_Mm02_00304703 predicted 883
9 SASI_Mm02_00304704 predicted 2630
10 SASI_Mm02_00304705 predicted 1694
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009722 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157827 predicted 1075
2 SASI_Mm01_00157828 predicted 817
3 SASI_Mm01_00157829 predicted 1577
4 SASI_Mm02_00316878 predicted 1740
5 SASI_Mm01_00157830 predicted 2280
6 SASI_Mm01_00157831 predicted 2538
7 SASI_Mm01_00157833 predicted 2139
8 SASI_Mm01_00157834 predicted 875
9 SASI_Mm01_00157835 predicted 2624
10 SASI_Mm01_00157836 predicted 1691
11 SASI_Mm01_00157832 predicted 376
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009722
VALIDATED
ATP2A2 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009722.3-810s21c1
Sequence:CCGGGCCGTTTGTAATTCTGCTTATCTCGAGATAAGCAGAATTACAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009722.3-1946s21c1
Sequence:CCGGACGCCTGCAACTCGGTCATAACTCGAGTTATGACCGAGTTGCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009722.3-1131s21c1
Sequence:CCGGCCGAGCTGTTAATCAAGACAACTCGAGTTGTCTTGATTAACAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009722.3-979s21c1
Sequence:CCGGCCTGGTGATATAGTGGAAATTCTCGAGAATTTCCACTATATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009722.1-3542s1c1
Sequence:CCGGGCCTCTCTAACTGTATGATAACTCGAGTTATCATACAGTTAGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009722.1-480s1c1
Sequence:CCGGGCCGTTTGTAATTCTGCTTATCTCGAGATAAGCAGAATTACAAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009722.1-801s1c1
Sequence:CCGGCCGAGCTGTTAATCAAGACAACTCGAGTTGTCTTGATTAACAGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009722.1-649s1c1
Sequence:CCGGCCTGGTGATATAGTGGAAATTCTCGAGAATTTCCACTATATCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009722.1-2015s1c1
Sequence:CCGGCCAGGATTGAAGTAGCCTCTTCTCGAGAAGAGGCTACTTCAATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009722
VALIDATED
ATP2A2 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009722.3-810s21c1
Sequence:CCGGGCCGTTTGTAATTCTGCTTATCTCGAGATAAGCAGAATTACAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009722.3-1946s21c1
Sequence:CCGGACGCCTGCAACTCGGTCATAACTCGAGTTATGACCGAGTTGCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009722.3-1131s21c1
Sequence:CCGGCCGAGCTGTTAATCAAGACAACTCGAGTTGTCTTGATTAACAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009722.3-979s21c1
Sequence:CCGGCCTGGTGATATAGTGGAAATTCTCGAGAATTTCCACTATATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009722.1-3542s1c1
Sequence:CCGGGCCTCTCTAACTGTATGATAACTCGAGTTATCATACAGTTAGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009722.1-480s1c1
Sequence:CCGGGCCGTTTGTAATTCTGCTTATCTCGAGATAAGCAGAATTACAAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009722.1-801s1c1
Sequence:CCGGCCGAGCTGTTAATCAAGACAACTCGAGTTGTCTTGATTAACAGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009722.1-649s1c1
Sequence:CCGGCCTGGTGATATAGTGGAAATTCTCGAGAATTTCCACTATATCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009722.1-2015s1c1
Sequence:CCGGCCAGGATTGAAGTAGCCTCTTCTCGAGAAGAGGCTACTTCAATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009722
VALIDATED
ATP2A2 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009722.3-810s21c1
Sequence:CCGGGCCGTTTGTAATTCTGCTTATCTCGAGATAAGCAGAATTACAAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321034    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009722.3-1946s21c1
Sequence:CCGGACGCCTGCAACTCGGTCATAACTCGAGTTATGACCGAGTTGCAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009722.3-1131s21c1
Sequence:CCGGCCGAGCTGTTAATCAAGACAACTCGAGTTGTCTTGATTAACAGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009722.3-979s21c1
Sequence:CCGGCCTGGTGATATAGTGGAAATTCTCGAGAATTTCCACTATATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012428    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009722.1-3542s1c1
Sequence:CCGGGCCTCTCTAACTGTATGATAACTCGAGTTATCATACAGTTAGAGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009722.1-480s1c1
Sequence:CCGGGCCGTTTGTAATTCTGCTTATCTCGAGATAAGCAGAATTACAAACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009722.1-801s1c1
Sequence:CCGGCCGAGCTGTTAATCAAGACAACTCGAGTTGTCTTGATTAACAGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009722.1-649s1c1
Sequence:CCGGCCTGGTGATATAGTGGAAATTCTCGAGAATTTCCACTATATCACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012430    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009722.1-2015s1c1
Sequence:CCGGCCAGGATTGAAGTAGCCTCTTCTCGAGAAGAGGCTACTTCAATCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001681
VALIDATED
ATP2A2 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-2810s21c1
Sequence:CCGGGCGGGCAATCTACAACAACATCTCGAGATGTTGTTGTAGATTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-1063s21c1
Sequence:CCGGCCATCAAATCTACCACACTAACTCGAGTTAGTGTGGTAGATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-1002s21c1
Sequence:CCGGCCTGGTGATATTGTAGAAATTCTCGAGAATTTCTACAATATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-1585s21c1
Sequence:CCGGCCCTTGGTTGTACTTCTGTTACTCGAGTAACAGAAGTACAACCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-3259s21c1
Sequence:CCGGCGCTCTCTGTTCTAGTAACTACTCGAGTAGTTACTAGAACAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001681.2-2410s1c1
Sequence:CCGGGCGGGCAATCTACAACAACATCTCGAGATGTTGTTGTAGATTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001681.2-602s1c1
Sequence:CCGGCCTGGTGATATTGTAGAAATTCTCGAGAATTTCTACAATATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001681.2-1185s1c1
Sequence:CCGGCCCTTGGTTGTACTTCTGTTACTCGAGTAACAGAAGTACAACCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001681.2-663s1c1
Sequence:CCGGCCATCAAATCTACCACACTAACTCGAGTTAGTGTGGTAGATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001681.2-2859s1c1
Sequence:CCGGCGCTCTCTGTTCTAGTAACTACTCGAGTAGTTACTAGAACAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001681
VALIDATED
ATP2A2 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-2810s21c1
Sequence:CCGGGCGGGCAATCTACAACAACATCTCGAGATGTTGTTGTAGATTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-1063s21c1
Sequence:CCGGCCATCAAATCTACCACACTAACTCGAGTTAGTGTGGTAGATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-1002s21c1
Sequence:CCGGCCTGGTGATATTGTAGAAATTCTCGAGAATTTCTACAATATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-1585s21c1
Sequence:CCGGCCCTTGGTTGTACTTCTGTTACTCGAGTAACAGAAGTACAACCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-3259s21c1
Sequence:CCGGCGCTCTCTGTTCTAGTAACTACTCGAGTAGTTACTAGAACAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001681.2-2410s1c1
Sequence:CCGGGCGGGCAATCTACAACAACATCTCGAGATGTTGTTGTAGATTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001681.2-602s1c1
Sequence:CCGGCCTGGTGATATTGTAGAAATTCTCGAGAATTTCTACAATATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001681.2-1185s1c1
Sequence:CCGGCCCTTGGTTGTACTTCTGTTACTCGAGTAACAGAAGTACAACCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001681.2-663s1c1
Sequence:CCGGCCATCAAATCTACCACACTAACTCGAGTTAGTGTGGTAGATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001681.2-2859s1c1
Sequence:CCGGCGCTCTCTGTTCTAGTAACTACTCGAGTAGTTACTAGAACAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001681
VALIDATED
ATP2A2 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, cardiac muscle, slow twitch 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-2810s21c1
Sequence:CCGGGCGGGCAATCTACAACAACATCTCGAGATGTTGTTGTAGATTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300233    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-1063s21c1
Sequence:CCGGCCATCAAATCTACCACACTAACTCGAGTTAGTGTGGTAGATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300234    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-1002s21c1
Sequence:CCGGCCTGGTGATATTGTAGAAATTCTCGAGAATTTCTACAATATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-1585s21c1
Sequence:CCGGCCCTTGGTTGTACTTCTGTTACTCGAGTAACAGAAGTACAACCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001681.3-3259s21c1
Sequence:CCGGCGCTCTCTGTTCTAGTAACTACTCGAGTAGTTACTAGAACAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001681.2-2410s1c1
Sequence:CCGGGCGGGCAATCTACAACAACATCTCGAGATGTTGTTGTAGATTGCCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001681.2-602s1c1
Sequence:CCGGCCTGGTGATATTGTAGAAATTCTCGAGAATTTCTACAATATCACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001681.2-1185s1c1
Sequence:CCGGCCCTTGGTTGTACTTCTGTTACTCGAGTAACAGAAGTACAACCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038533    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001681.2-663s1c1
Sequence:CCGGCCATCAAATCTACCACACTAACTCGAGTTAGTGTGGTAGATTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001681.2-2859s1c1
Sequence:CCGGCGCTCTCTGTTCTAGTAACTACTCGAGTAGTTACTAGAACAGAGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks