EMAIL THIS PAGE TO A FRIEND

ATP2A3

ATPase, Ca++ transporting, ubiquitous

126 Gene Product Result for
Synonyms: SERCA3
Gene ID:
Human(489) Summary: This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in calcium sequestration associated with muscular excitation and contraction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(53313) ATPase, Ca++ transporting, ubiquitous
Rat(25391) ATPase, Ca++ transporting, ubiquitous
Zebrafish(568671) ATPase, Ca++ transporting, ubiquitous
chicken(395707) ATPase, Ca++ transporting, ubiquitous
domestic cat(101101678) ATPase, Ca++ transporting, ubiquitous
cow(512313) ATPase, Ca++ transporting, ubiquitous
Horse(100072684) ATPase, Ca++ transporting, ubiquitous
dog(491437) ATPase, Ca++ transporting, ubiquitous
sheep(101111207) ATPase, Ca++ transporting, ubiquitous
Domestic Rabbit(100354976) ATPase, Ca++ transporting, ubiquitous
domestic guinea pig(100174979) ATPase, Ca++ transporting, ubiquitous
naked mole-rat(101726683) ATPase, Ca++ transporting, ubiquitous
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005173 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005173 Rosetta Predictions human pricing
NM_174953 Rosetta Predictions human pricing
NM_174954 Rosetta Predictions human pricing
NM_174955 Rosetta Predictions human pricing
NM_174956 Rosetta Predictions human pricing
NM_174957 Rosetta Predictions human pricing
NM_174958 Rosetta Predictions human pricing
NM_012914 Rosetta Predictions rat pricing
NM_016745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081969 predicted 1616
2 SASI_Hs01_00081970 predicted 2789
3 SASI_Hs02_00339122 predicted 1482
4 SASI_Hs01_00081971 predicted 1887
5 SASI_Hs01_00081972 predicted 1559
6 SASI_Hs01_00081973 predicted 2289
7 SASI_Hs01_00081974 predicted 1240
8 SASI_Hs01_00081975 predicted 2885
9 SASI_Hs01_00081977 predicted 2651
10 SASI_Hs01_00081978 predicted 1603
11 SASI_Hs01_00081976 predicted 1025
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174953 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241426 predicted 1613
2 SASI_Hs01_00241427 predicted 2791
3 SASI_Hs02_00368890 predicted 1479
4 SASI_Hs01_00241428 predicted 1892
5 SASI_Hs01_00241429 predicted 1557
6 SASI_Hs01_00241430 predicted 2290
7 SASI_Hs01_00241431 predicted 1237
8 SASI_Hs01_00241432 predicted 2886
9 SASI_Hs01_00241434 predicted 2653
10 SASI_Hs01_00241435 predicted 1597
11 SASI_Hs01_00241433 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174954 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115295 predicted 1622
2 SASI_Hs01_00115296 predicted 2790
3 SASI_Hs02_00368891 predicted 1475
4 SASI_Hs01_00115297 predicted 1893
5 SASI_Hs01_00115298 predicted 1557
6 SASI_Hs01_00115299 predicted 2288
7 SASI_Hs01_00115300 predicted 1236
8 SASI_Hs01_00115301 predicted 2887
9 SASI_Hs01_00115303 predicted 2654
10 SASI_Hs01_00115304 predicted 1603
11 SASI_Hs01_00115302 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174955 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067844 predicted 1620
2 SASI_Hs01_00067845 predicted 2794
3 SASI_Hs02_00368892 predicted 1482
4 SASI_Hs01_00067846 predicted 1889
5 SASI_Hs01_00067847 predicted 1552
6 SASI_Hs01_00067848 predicted 2291
7 SASI_Hs01_00067849 predicted 1244
8 SASI_Hs01_00067850 predicted 2884
9 SASI_Hs01_00067852 predicted 2650
10 SASI_Hs01_00067853 predicted 1604
11 SASI_Hs01_00067851 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174956 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245802 predicted 1620
2 SASI_Hs01_00245803 predicted 2785
3 SASI_Hs02_00368893 predicted 1480
4 SASI_Hs01_00245804 predicted 1887
5 SASI_Hs01_00245805 predicted 1551
6 SASI_Hs01_00245806 predicted 2290
7 SASI_Hs01_00245807 predicted 1244
8 SASI_Hs01_00245808 predicted 2880
9 SASI_Hs01_00245810 predicted 2648
10 SASI_Hs01_00245811 predicted 1599
11 SASI_Hs01_00245809 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174957 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221158 predicted 1617
2 SASI_Hs01_00221159 predicted 2792
3 SASI_Hs02_00368894 predicted 1478
4 SASI_Hs01_00221160 predicted 1894
5 SASI_Hs01_00221161 predicted 1554
6 SASI_Hs01_00221162 predicted 2282
7 SASI_Hs01_00221163 predicted 1236
8 SASI_Hs01_00221164 predicted 2880
9 SASI_Hs01_00221166 predicted 2656
10 SASI_Hs01_00221167 predicted 1598
11 SASI_Hs01_00221165 predicted 1024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174958 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078008 predicted 1618
2 SASI_Hs01_00078009 predicted 2785
3 SASI_Hs02_00368895 predicted 1480
4 SASI_Hs01_00078010 predicted 1887
5 SASI_Hs01_00078011 predicted 1558
6 SASI_Hs01_00078012 predicted 2288
7 SASI_Hs01_00078013 predicted 1244
8 SASI_Hs01_00078014 predicted 2886
9 SASI_Hs01_00078016 predicted 2651
10 SASI_Hs01_00078017 predicted 1601
11 SASI_Hs01_00078015 predicted 1031
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00260450 predicted 2063
2 SASI_Rn01_00036473 predicted 467
3 SASI_Rn01_00036474 predicted 1871
4 SASI_Rn01_00036475 predicted 1223
5 SASI_Rn01_00036476 predicted 2695
6 SASI_Rn01_00036477 predicted 2270
7 SASI_Rn01_00036479 predicted 490
8 SASI_Rn01_00036480 predicted 2819
9 SASI_Rn01_00036481 predicted 759
10 SASI_Rn01_00036482 predicted 3054
11 SASI_Rn01_00036478 predicted 2776
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162807 predicted 2575
2 SASI_Mm02_00323469 predicted 2525
3 SASI_Mm01_00162808 predicted 1242
4 SASI_Mm01_00162810 predicted 2735
5 SASI_Mm01_00162813 predicted 2161
6 SASI_Mm01_00162814 predicted 3020
7 SASI_Mm01_00162815 predicted 461
8 SASI_Mm02_00323470 predicted 2031
9 SASI_Mm01_00162816 predicted 3281
10 SASI_Mm02_00323471 predicted 2788
11 SASI_Mm01_00162809 predicted 2324
12 SASI_Mm01_00162811 predicted 2236
13 SASI_Mm01_00162812 predicted 2287
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016745
ATP2A3 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, ubiquitous
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016745.2-1713s1c1
Sequence:CCGGCACCACTTCCAGAGAGCATATCTCGAGATATGCTCTCTGGAAGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016745.2-2139s1c1
Sequence:CCGGACCCGCACATAAGTCTCGAATCTCGAGATTCGAGACTTATGTGCGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016745.2-4120s1c1
Sequence:CCGGGAACGTACATTGCTCTTCTTTCTCGAGAAAGAAGAGCAATGTACGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016745.2-3076s1c1
Sequence:CCGGGATGGTGTTCTCGGGACATTTCTCGAGAAATGTCCCGAGAACACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016745.2-1223s1c1
Sequence:CCGGGCACCTGTCGTTTGCATGAATCTCGAGATTCATGCAAACGACAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016745.3-2250s21c1
Sequence:CCGGGAGAACCTACAGTCCTTTAATCTCGAGATTAAAGGACTGTAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016745.3-513s21c1
Sequence:CCGGCGCAACGCAGAGAGTGCAATTCTCGAGAATTGCACTCTCTGCGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016745.3-1156s21c1
Sequence:CCGGGACGTATGGCACGTAAGAATGCTCGAGCATTCTTACGTGCCATACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016745
ATP2A3 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, ubiquitous
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016745.2-1713s1c1
Sequence:CCGGCACCACTTCCAGAGAGCATATCTCGAGATATGCTCTCTGGAAGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016745.2-2139s1c1
Sequence:CCGGACCCGCACATAAGTCTCGAATCTCGAGATTCGAGACTTATGTGCGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016745.2-4120s1c1
Sequence:CCGGGAACGTACATTGCTCTTCTTTCTCGAGAAAGAAGAGCAATGTACGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016745.2-3076s1c1
Sequence:CCGGGATGGTGTTCTCGGGACATTTCTCGAGAAATGTCCCGAGAACACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016745.2-1223s1c1
Sequence:CCGGGCACCTGTCGTTTGCATGAATCTCGAGATTCATGCAAACGACAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016745.3-2250s21c1
Sequence:CCGGGAGAACCTACAGTCCTTTAATCTCGAGATTAAAGGACTGTAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016745.3-513s21c1
Sequence:CCGGCGCAACGCAGAGAGTGCAATTCTCGAGAATTGCACTCTCTGCGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016745.3-1156s21c1
Sequence:CCGGGACGTATGGCACGTAAGAATGCTCGAGCATTCTTACGTGCCATACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016745
ATP2A3 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, ubiquitous
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016745.2-1713s1c1
Sequence:CCGGCACCACTTCCAGAGAGCATATCTCGAGATATGCTCTCTGGAAGTGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016745.2-2139s1c1
Sequence:CCGGACCCGCACATAAGTCTCGAATCTCGAGATTCGAGACTTATGTGCGGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012433    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016745.2-4120s1c1
Sequence:CCGGGAACGTACATTGCTCTTCTTTCTCGAGAAAGAAGAGCAATGTACGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016745.2-3076s1c1
Sequence:CCGGGATGGTGTTCTCGGGACATTTCTCGAGAAATGTCCCGAGAACACCATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016745.2-1223s1c1
Sequence:CCGGGCACCTGTCGTTTGCATGAATCTCGAGATTCATGCAAACGACAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016745.3-2250s21c1
Sequence:CCGGGAGAACCTACAGTCCTTTAATCTCGAGATTAAAGGACTGTAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016745.3-513s21c1
Sequence:CCGGCGCAACGCAGAGAGTGCAATTCTCGAGAATTGCACTCTCTGCGTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016745.3-1156s21c1
Sequence:CCGGGACGTATGGCACGTAAGAATGCTCGAGCATTCTTACGTGCCATACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005173
ATP2A3 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, ubiquitous
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-3127s1c1
Sequence:CCGGGCACGAAGAAATGAGCCAGAACTCGAGTTCTGGCTCATTTCTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-1558s1c1
Sequence:CCGGCGCCTGTAACACGGTCATCAACTCGAGTTGATGACCGTGTTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-1024s1c1
Sequence:CCGGCGCTGTCTACTACTTCAAGATCTCGAGATCTTGAAGTAGTAGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-2857s1c1
Sequence:CCGGCGTGCTCGTGACCATTGAAATCTCGAGATTTCAATGGTCACGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-758s1c1
Sequence:CCGGGACAAGAAGAACATGCTGTTTCTCGAGAAACAGCATGTTCTTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005173.2-1083s21c1
Sequence:CCGGTCCCGGCTGTCATCACTACATCTCGAGATGTAGTGATGACAGCCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005173.2-2216s21c1
Sequence:CCGGGAGAACCTGCAGTCCTTTAACCTCGAGGTTAAAGGACTGCAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005173.2-786s21c1
Sequence:CCGGCCAATATCACATCGGGCAAAGCTCGAGCTTTGCCCGATGTGATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005173
ATP2A3 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, ubiquitous
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-3127s1c1
Sequence:CCGGGCACGAAGAAATGAGCCAGAACTCGAGTTCTGGCTCATTTCTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-1558s1c1
Sequence:CCGGCGCCTGTAACACGGTCATCAACTCGAGTTGATGACCGTGTTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-1024s1c1
Sequence:CCGGCGCTGTCTACTACTTCAAGATCTCGAGATCTTGAAGTAGTAGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-2857s1c1
Sequence:CCGGCGTGCTCGTGACCATTGAAATCTCGAGATTTCAATGGTCACGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-758s1c1
Sequence:CCGGGACAAGAAGAACATGCTGTTTCTCGAGAAACAGCATGTTCTTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005173.2-1083s21c1
Sequence:CCGGTCCCGGCTGTCATCACTACATCTCGAGATGTAGTGATGACAGCCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005173.2-2216s21c1
Sequence:CCGGGAGAACCTGCAGTCCTTTAACCTCGAGGTTAAAGGACTGCAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005173.2-786s21c1
Sequence:CCGGCCAATATCACATCGGGCAAAGCTCGAGCTTTGCCCGATGTGATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005173
ATP2A3 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, ubiquitous
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-3127s1c1
Sequence:CCGGGCACGAAGAAATGAGCCAGAACTCGAGTTCTGGCTCATTTCTTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-1558s1c1
Sequence:CCGGCGCCTGTAACACGGTCATCAACTCGAGTTGATGACCGTGTTACAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-1024s1c1
Sequence:CCGGCGCTGTCTACTACTTCAAGATCTCGAGATCTTGAAGTAGTAGACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-2857s1c1
Sequence:CCGGCGTGCTCGTGACCATTGAAATCTCGAGATTTCAATGGTCACGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005173.2-758s1c1
Sequence:CCGGGACAAGAAGAACATGCTGTTTCTCGAGAAACAGCATGTTCTTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436923    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005173.2-1083s21c1
Sequence:CCGGTCCCGGCTGTCATCACTACATCTCGAGATGTAGTGATGACAGCCGGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005173.2-2216s21c1
Sequence:CCGGGAGAACCTGCAGTCCTTTAACCTCGAGGTTAAAGGACTGCAGGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005173.2-786s21c1
Sequence:CCGGCCAATATCACATCGGGCAAAGCTCGAGCTTTGCCCGATGTGATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks