EMAIL THIS PAGE TO A FRIEND

ATP2B1

ATPase, Ca++ transporting, plasma membrane 1

Synonyms: PMCA1 PMCA1kb
Gene ID:
Human(490) Summary: The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 1. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(67972) ATPase, Ca++ transporting, plasma membrane 1
Rat(29598) ATPase, Ca++ transporting, plasma membrane 1
naked mole-rat(101725886) ATPase, Ca++ transporting, plasma membrane 1
domestic guinea pig(100337638) ATPase, Ca++ transporting, plasma membrane 1
sheep(101111268) ATPase, Ca++ transporting, plasma membrane 1
Domestic Rabbit(100009543) ATPase, Ca++ transporting, plasma membrane 1
chicken(374244) ATPase, Ca++ transporting, plasma membrane 1
cow(282641) ATPase, Ca++ transporting, plasma membrane 1
Horse(100051636) ATPase, Ca++ transporting, plasma membrane 1
domestic cat(101098392) ATPase, Ca++ transporting, plasma membrane 1
dog(403480) ATPase, Ca++ transporting, plasma membrane 1
Gene Class: ATPase
278 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001323 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026482 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026482 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026482 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001323 Rosetta Predictions human pricing
NM_001682 Rosetta Predictions human pricing
NM_053311 Rosetta Predictions rat pricing
NM_026482 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039081 predicted 2180
2 SASI_Hs01_00039083 predicted 2600
3 SASI_Hs01_00039084 predicted 1706
4 SASI_Hs02_00303714 predicted 533
5 SASI_Hs01_00039085 predicted 2747
6 SASI_Hs01_00039086 predicted 1682
7 SASI_Hs02_00303715 predicted 813
8 SASI_Hs02_00303716 predicted 580
9 SASI_Hs01_00039089 predicted 786
10 SASI_Hs02_00303717 predicted 2991
11 SASI_Hs01_00039082 predicted 2625
12 SASI_Hs01_00039087 predicted 1505
13 SASI_Hs01_00039088 predicted 3001
14 SASI_Hs01_00039090 predicted 1744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001682 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241406 predicted 3756
2 SASI_Hs01_00241407 predicted 2185
3 SASI_Hs01_00241409 predicted 2599
4 SASI_Hs01_00241410 predicted 1712
5 SASI_Hs02_00332332 predicted 529
6 SASI_Hs01_00241411 predicted 2751
7 SASI_Hs02_00332333 predicted 813
8 SASI_Hs02_00332334 predicted 581
9 SASI_Hs01_00241415 predicted 789
10 SASI_Hs02_00332335 predicted 2990
11 SASI_Hs01_00241408 predicted 2620
12 SASI_Hs01_00241412 predicted 1692
13 SASI_Hs01_00241413 predicted 1502
14 SASI_Hs01_00241414 predicted 2999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036175 predicted 1931
2 SASI_Rn01_00036176 predicted 1794
3 SASI_Rn01_00036177 predicted 2253
4 SASI_Rn01_00036178 predicted 583
5 SASI_Rn01_00036179 predicted 2720
6 SASI_Rn01_00036180 predicted 2867
7 SASI_Rn01_00036181 predicted 1486
8 SASI_Rn01_00036183 predicted 914
9 SASI_Rn01_00036184 predicted 1815
10 SASI_Rn02_00265723 predicted 3064
11 SASI_Rn01_00036182 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026482 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150663 predicted 1825
2 SASI_Mm01_00150664 predicted 1031
3 SASI_Mm01_00150665 predicted 716
4 SASI_Mm01_00150666 predicted 1786
5 SASI_Mm01_00150667 predicted 439
6 SASI_Mm01_00150668 predicted 1607
7 SASI_Mm01_00150669 predicted 3032
8 SASI_Mm02_00330353 predicted 1736
9 SASI_Mm01_00150670 predicted 430
10 SASI_Mm01_00150671 predicted 733
11 SASI_Mm01_00150672 predicted 769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001323
ATP2B1 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, plasma membrane 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000333526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001323.1-1772s21c1
Sequence:CCGGCCAGAGAAAGAGGGTGGATTACTCGAGTAATCCACCCTCTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001323.1-862s21c1
Sequence:CCGGCGGCATACTTATTCAAGGCAACTCGAGTTGCCTTGAATAAGTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001323.1-2944s21c1
Sequence:CCGGGCCTCTCATCTCACGTACAATCTCGAGATTGTACGTGAGATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001323.1-407s21c1
Sequence:CCGGGCAGATTTAGAAAGAAGAGAACTCGAGTTCTCTTCTTTCTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001323.1-4599s21c1
Sequence:CCGGGCCTACAATTTACCTTGTTAACTCGAGTTAACAAGGTAAATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001323.1-4599s1c1
Sequence:CCGGGCCTACAATTTACCTTGTTAACTCGAGTTAACAAGGTAAATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001323.1-1772s1c1
Sequence:CCGGCCAGAGAAAGAGGGTGGATTACTCGAGTAATCCACCCTCTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001323.1-862s1c1
Sequence:CCGGCGGCATACTTATTCAAGGCAACTCGAGTTGCCTTGAATAAGTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001323.1-407s1c1
Sequence:CCGGGCAGATTTAGAAAGAAGAGAACTCGAGTTCTCTTCTTTCTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001323.1-2944s1c1
Sequence:CCGGGCCTCTCATCTCACGTACAATCTCGAGATTGTACGTGAGATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001323
ATP2B1 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, plasma membrane 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000333526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001323.1-1772s21c1
Sequence:CCGGCCAGAGAAAGAGGGTGGATTACTCGAGTAATCCACCCTCTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001323.1-862s21c1
Sequence:CCGGCGGCATACTTATTCAAGGCAACTCGAGTTGCCTTGAATAAGTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001323.1-2944s21c1
Sequence:CCGGGCCTCTCATCTCACGTACAATCTCGAGATTGTACGTGAGATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001323.1-407s21c1
Sequence:CCGGGCAGATTTAGAAAGAAGAGAACTCGAGTTCTCTTCTTTCTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001323.1-4599s21c1
Sequence:CCGGGCCTACAATTTACCTTGTTAACTCGAGTTAACAAGGTAAATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001323.1-4599s1c1
Sequence:CCGGGCCTACAATTTACCTTGTTAACTCGAGTTAACAAGGTAAATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001323.1-1772s1c1
Sequence:CCGGCCAGAGAAAGAGGGTGGATTACTCGAGTAATCCACCCTCTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001323.1-862s1c1
Sequence:CCGGCGGCATACTTATTCAAGGCAACTCGAGTTGCCTTGAATAAGTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001323.1-407s1c1
Sequence:CCGGGCAGATTTAGAAAGAAGAGAACTCGAGTTCTCTTCTTTCTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001323.1-2944s1c1
Sequence:CCGGGCCTCTCATCTCACGTACAATCTCGAGATTGTACGTGAGATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001323
ATP2B1 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, plasma membrane 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000333526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001323.1-1772s21c1
Sequence:CCGGCCAGAGAAAGAGGGTGGATTACTCGAGTAATCCACCCTCTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001323.1-862s21c1
Sequence:CCGGCGGCATACTTATTCAAGGCAACTCGAGTTGCCTTGAATAAGTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001323.1-2944s21c1
Sequence:CCGGGCCTCTCATCTCACGTACAATCTCGAGATTGTACGTGAGATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333464    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001323.1-407s21c1
Sequence:CCGGGCAGATTTAGAAAGAAGAGAACTCGAGTTCTCTTCTTTCTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333527    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001323.1-4599s21c1
Sequence:CCGGGCCTACAATTTACCTTGTTAACTCGAGTTAACAAGGTAAATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043068    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001323.1-4599s1c1
Sequence:CCGGGCCTACAATTTACCTTGTTAACTCGAGTTAACAAGGTAAATTGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001323.1-1772s1c1
Sequence:CCGGCCAGAGAAAGAGGGTGGATTACTCGAGTAATCCACCCTCTTTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043072    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001323.1-862s1c1
Sequence:CCGGCGGCATACTTATTCAAGGCAACTCGAGTTGCCTTGAATAAGTATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043071    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001323.1-407s1c1
Sequence:CCGGGCAGATTTAGAAAGAAGAGAACTCGAGTTCTCTTCTTTCTAAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001323.1-2944s1c1
Sequence:CCGGGCCTCTCATCTCACGTACAATCTCGAGATTGTACGTGAGATGAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026482
VALIDATED
ATP2B1 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, plasma membrane 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026482.1-4444s1c1
Sequence:CCGGCCCTGGATCATTGAGTGAATACTCGAGTATTCACTCAATGATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026482.1-2232s1c1
Sequence:CCGGGCCTCCGAGATCATTCTGAAACTCGAGTTTCAGAATGATCTCGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026482.1-3613s1c1
Sequence:CCGGCCAGCCGCTTAAAGTTTCTAACTCGAGTTAGAAACTTTAAGCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026482.1-1943s1c1
Sequence:CCGGCCCACCAAATATCCTGTCCTACTCGAGTAGGACAGGATATTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026482.1-778s1c1
Sequence:CCGGCCATAGTATCATTGGGCCTTTCTCGAGAAAGGCCCAATGATACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026482
VALIDATED
ATP2B1 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, plasma membrane 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026482.1-4444s1c1
Sequence:CCGGCCCTGGATCATTGAGTGAATACTCGAGTATTCACTCAATGATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026482.1-2232s1c1
Sequence:CCGGGCCTCCGAGATCATTCTGAAACTCGAGTTTCAGAATGATCTCGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026482.1-3613s1c1
Sequence:CCGGCCAGCCGCTTAAAGTTTCTAACTCGAGTTAGAAACTTTAAGCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026482.1-1943s1c1
Sequence:CCGGCCCACCAAATATCCTGTCCTACTCGAGTAGGACAGGATATTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026482.1-778s1c1
Sequence:CCGGCCATAGTATCATTGGGCCTTTCTCGAGAAAGGCCCAATGATACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026482
VALIDATED
ATP2B1 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, plasma membrane 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101640    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026482.1-4444s1c1
Sequence:CCGGCCCTGGATCATTGAGTGAATACTCGAGTATTCACTCAATGATCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026482.1-2232s1c1
Sequence:CCGGGCCTCCGAGATCATTCTGAAACTCGAGTTTCAGAATGATCTCGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026482.1-3613s1c1
Sequence:CCGGCCAGCCGCTTAAAGTTTCTAACTCGAGTTAGAAACTTTAAGCGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101641    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026482.1-1943s1c1
Sequence:CCGGCCCACCAAATATCCTGTCCTACTCGAGTAGGACAGGATATTTGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101642    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026482.1-778s1c1
Sequence:CCGGCCATAGTATCATTGGGCCTTTCTCGAGAAAGGCCCAATGATACTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks