EMAIL THIS PAGE TO A FRIEND

ATP2B2

ATPase, Ca++ transporting, plasma membrane 2

71 Gene Product Result for
Synonyms: PMCA2 PMCA2a PMCA2i
UniProtKB ID: Q01814, O00766, Q12994, Q16818
Gene ID:
Human(491) Summary: The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 2. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(11941) ATPase, Ca++ transporting, plasma membrane 2
Rat(24215) ATPase, Ca++ transporting, plasma membrane 2
Zebrafish(557430) ATPase, Ca++ transporting, plasma membrane 2
chicken(415958) ATPase, Ca++ transporting, plasma membrane 2
domestic cat(101087822) ATPase, Ca++ transporting, plasma membrane 2
cow(613800) ATPase, Ca++ transporting, plasma membrane 2
dog(476535) ATPase, Ca++ transporting, plasma membrane 2
sheep(101121046) ATPase, Ca++ transporting, plasma membrane 2
domestic guinea pig(100728391) ATPase, Ca++ transporting, plasma membrane 2
naked mole-rat(101707619) ATPase, Ca++ transporting, plasma membrane 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
P1244 Anti-PMCA2 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, rat
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009723 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009723 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009723 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001331 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001331 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001331 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127691 MISSION® esiRNA esiRNA human ATP2B2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001331 Rosetta Predictions human pricing
NM_001683 Rosetta Predictions human pricing
NM_012508 Rosetta Predictions rat pricing
NM_001036684 Rosetta Predictions mouse pricing
NM_009723 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001331 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155229 predicted 2625
2 SASI_Hs01_00155230 predicted 3154
3 SASI_Hs01_00155231 predicted 4036
4 SASI_Hs01_00155232 predicted 319
5 SASI_Hs01_00155233 predicted 3730
6 SASI_Hs01_00155234 predicted 1854
7 SASI_Hs02_00303720 predicted 3824
8 SASI_Hs02_00303721 predicted 3024
9 SASI_Hs01_00155235 predicted 3438
10 SASI_Hs01_00155236 predicted 3185
11 SASI_Hs01_00155237 predicted 3431
12 SASI_Hs01_00155238 predicted 3982
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001683 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025335 predicted 2492
2 SASI_Hs01_00025336 predicted 3015
3 SASI_Hs01_00025337 predicted 3903
4 SASI_Hs01_00025338 predicted 322
5 SASI_Hs01_00025339 predicted 3594
6 SASI_Hs01_00025340 predicted 1724
7 SASI_Hs02_00332336 predicted 3694
8 SASI_Hs02_00332337 predicted 2893
9 SASI_Hs01_00025341 predicted 3305
10 SASI_Hs01_00025342 predicted 3055
11 SASI_Hs01_00025343 predicted 3301
12 SASI_Hs01_00025344 predicted 3851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00075765 predicted 542
2 SASI_Rn01_00075766 predicted 2726
3 SASI_Rn01_00075767 predicted 3826
4 SASI_Rn01_00075768 predicted 1626
5 SASI_Rn01_00075769 predicted 3917
6 SASI_Rn01_00075770 predicted 2479
7 SASI_Rn01_00075771 predicted 3462
8 SASI_Rn01_00075773 predicted 2003
9 SASI_Rn01_00075774 predicted 3679
10 SASI_Rn02_00259561 predicted 2191
11 SASI_Rn01_00075772 predicted 2008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001036684 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00081887 predicted 2081
2 SASI_Mm01_00081888 predicted 2616
3 SASI_Mm01_00081890 predicted 3710
4 SASI_Mm01_00081891 predicted 3808
5 SASI_Mm01_00081892 predicted 3574
6 SASI_Mm01_00081893 predicted 2366
7 SASI_Mm01_00081894 predicted 3417
8 SASI_Mm01_00081895 predicted 1421
9 SASI_Mm01_00081896 predicted 3964
10 SASI_Mm02_00289275 predicted 2693
11 SASI_Mm01_00081889 predicted 1526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009723 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00027773 predicted 2216
2 SASI_Mm01_00027774 predicted 2750
3 SASI_Mm01_00027776 predicted 3854
4 SASI_Mm01_00027777 predicted 3941
5 SASI_Mm01_00027778 predicted 3705
6 SASI_Mm01_00027779 predicted 2503
7 SASI_Mm01_00027780 predicted 3543
8 SASI_Mm01_00027781 predicted 1564
9 SASI_Mm01_00027782 predicted 4103
10 SASI_Mm02_00316879 predicted 2829
11 SASI_Mm01_00027775 predicted 1663
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009723
ATP2B2 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, plasma membrane 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009723.1-4111s1c1
Sequence:CCGGGCACACCCTTCCAGGCACCAACTCGAGTTGGTGCCTGGAAGGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009723.1-3990s1c1
Sequence:CCGGCGAGCAAATCAGCTACCTCTTCTCGAGAAGAGGTAGCTGATTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009723.1-775s1c1
Sequence:CCGGGACACTTATCATCCTGGAGATCTCGAGATCTCCAGGATGATAAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009723.1-1720s1c1
Sequence:CCGGACTGGCCTATTCTGTGAAGAACTCGAGTTCTTCACAGAATAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009723.1-1622s1c1
Sequence:CCGGCCCGTCTACGTACAGTACTTTCTCGAGAAAGTACTGTACGTAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009723.2-2661s21c1
Sequence:CCGGTCGCCATCAAGTGTGGCATTACTCGAGTAATGCCACACTTGATGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009723.2-2393s21c1
Sequence:CCGGGACAGGGATGAGATGGTTAAGCTCGAGCTTAACCATCTCATCCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009723.2-4525s21c1
Sequence:CCGGTGAATGTACCTGGACACTATTCTCGAGAATAGTGTCCAGGTACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009723.2-1413s21c1
Sequence:CCGGCTCAGACTGGCATCATATTTACTCGAGTAAATATGATGCCAGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009723.2-3045s21c1
Sequence:CCGGGTAACGTCTATGACAGCATATCTCGAGATATGCTGTCATAGACGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009723
ATP2B2 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, plasma membrane 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009723.1-4111s1c1
Sequence:CCGGGCACACCCTTCCAGGCACCAACTCGAGTTGGTGCCTGGAAGGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009723.1-3990s1c1
Sequence:CCGGCGAGCAAATCAGCTACCTCTTCTCGAGAAGAGGTAGCTGATTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009723.1-775s1c1
Sequence:CCGGGACACTTATCATCCTGGAGATCTCGAGATCTCCAGGATGATAAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009723.1-1720s1c1
Sequence:CCGGACTGGCCTATTCTGTGAAGAACTCGAGTTCTTCACAGAATAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009723.1-1622s1c1
Sequence:CCGGCCCGTCTACGTACAGTACTTTCTCGAGAAAGTACTGTACGTAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009723.2-2661s21c1
Sequence:CCGGTCGCCATCAAGTGTGGCATTACTCGAGTAATGCCACACTTGATGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009723.2-2393s21c1
Sequence:CCGGGACAGGGATGAGATGGTTAAGCTCGAGCTTAACCATCTCATCCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009723.2-4525s21c1
Sequence:CCGGTGAATGTACCTGGACACTATTCTCGAGAATAGTGTCCAGGTACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009723.2-1413s21c1
Sequence:CCGGCTCAGACTGGCATCATATTTACTCGAGTAAATATGATGCCAGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009723.2-3045s21c1
Sequence:CCGGGTAACGTCTATGACAGCATATCTCGAGATATGCTGTCATAGACGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009723
ATP2B2 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, plasma membrane 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009723.1-4111s1c1
Sequence:CCGGGCACACCCTTCCAGGCACCAACTCGAGTTGGTGCCTGGAAGGGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009723.1-3990s1c1
Sequence:CCGGCGAGCAAATCAGCTACCTCTTCTCGAGAAGAGGTAGCTGATTTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009723.1-775s1c1
Sequence:CCGGGACACTTATCATCCTGGAGATCTCGAGATCTCCAGGATGATAAGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009723.1-1720s1c1
Sequence:CCGGACTGGCCTATTCTGTGAAGAACTCGAGTTCTTCACAGAATAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009723.1-1622s1c1
Sequence:CCGGCCCGTCTACGTACAGTACTTTCTCGAGAAAGTACTGTACGTAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009723.2-2661s21c1
Sequence:CCGGTCGCCATCAAGTGTGGCATTACTCGAGTAATGCCACACTTGATGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436963    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009723.2-2393s21c1
Sequence:CCGGGACAGGGATGAGATGGTTAAGCTCGAGCTTAACCATCTCATCCCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009723.2-4525s21c1
Sequence:CCGGTGAATGTACCTGGACACTATTCTCGAGAATAGTGTCCAGGTACATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009723.2-1413s21c1
Sequence:CCGGCTCAGACTGGCATCATATTTACTCGAGTAAATATGATGCCAGTCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009723.2-3045s21c1
Sequence:CCGGGTAACGTCTATGACAGCATATCTCGAGATATGCTGTCATAGACGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001331
ATP2B2 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, plasma membrane 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001331.1-5664s1c1
Sequence:CCGGCCCACTTAATAAGAGCTTATTCTCGAGAATAAGCTCTTATTAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001331.1-1304s1c1
Sequence:CCGGGCCAGCCTAGTCAATGGTAAACTCGAGTTTACCATTGACTAGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001331.1-3505s1c1
Sequence:CCGGCCAGTGGATGTGGTGCATATTCTCGAGAATATGCACCACATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001331.1-3445s1c1
Sequence:CCGGCCAGATAGTGATCGTGCAGTTCTCGAGAACTGCACGATCACTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001331.1-2281s1c1
Sequence:CCGGCGAGATGGTAAAGAAGGTGATCTCGAGATCACCTTCTTTACCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001331.2-2622s21c1
Sequence:CCGGGCATGGTCACTGGCGACAATACTCGAGTATTGTCGCCAGTGACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001331.2-1740s21c1
Sequence:CCGGCCGTCTACGTGCAGTACTTTGCTCGAGCAAAGTACTGCACGTAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001331.2-2993s21c1
Sequence:CCGGATCCTGACAGACGACAATTTCCTCGAGGAAATTGTCGTCTGTCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001331
ATP2B2 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, plasma membrane 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001331.1-5664s1c1
Sequence:CCGGCCCACTTAATAAGAGCTTATTCTCGAGAATAAGCTCTTATTAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001331.1-1304s1c1
Sequence:CCGGGCCAGCCTAGTCAATGGTAAACTCGAGTTTACCATTGACTAGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001331.1-3505s1c1
Sequence:CCGGCCAGTGGATGTGGTGCATATTCTCGAGAATATGCACCACATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001331.1-3445s1c1
Sequence:CCGGCCAGATAGTGATCGTGCAGTTCTCGAGAACTGCACGATCACTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001331.1-2281s1c1
Sequence:CCGGCGAGATGGTAAAGAAGGTGATCTCGAGATCACCTTCTTTACCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001331.2-2622s21c1
Sequence:CCGGGCATGGTCACTGGCGACAATACTCGAGTATTGTCGCCAGTGACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001331.2-1740s21c1
Sequence:CCGGCCGTCTACGTGCAGTACTTTGCTCGAGCAAAGTACTGCACGTAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001331.2-2993s21c1
Sequence:CCGGATCCTGACAGACGACAATTTCCTCGAGGAAATTGTCGTCTGTCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001331
ATP2B2 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, plasma membrane 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001331.1-5664s1c1
Sequence:CCGGCCCACTTAATAAGAGCTTATTCTCGAGAATAAGCTCTTATTAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001331.1-1304s1c1
Sequence:CCGGGCCAGCCTAGTCAATGGTAAACTCGAGTTTACCATTGACTAGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001331.1-3505s1c1
Sequence:CCGGCCAGTGGATGTGGTGCATATTCTCGAGAATATGCACCACATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001331.1-3445s1c1
Sequence:CCGGCCAGATAGTGATCGTGCAGTTCTCGAGAACTGCACGATCACTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001331.1-2281s1c1
Sequence:CCGGCGAGATGGTAAAGAAGGTGATCTCGAGATCACCTTCTTTACCATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001331.2-2622s21c1
Sequence:CCGGGCATGGTCACTGGCGACAATACTCGAGTATTGTCGCCAGTGACCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001331.2-1740s21c1
Sequence:CCGGCCGTCTACGTGCAGTACTTTGCTCGAGCAAAGTACTGCACGTAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001331.2-2993s21c1
Sequence:CCGGATCCTGACAGACGACAATTTCCTCGAGGAAATTGTCGTCTGTCAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks