EMAIL THIS PAGE TO A FRIEND

ATP2B3

ATPase, Ca++ transporting, plasma membrane 3

Synonyms: PMCA3 PMCA3a SCAX1
UniProtKB ID: Q16720, B7WNR8, B7WNY5, Q12995, Q16858
Gene ID:
Human(492) Summary: The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 3. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(320707) ATPase, Ca++ transporting, plasma membrane 3
Rat(29599) ATPase, Ca++ transporting, plasma membrane 3
dog(492238) ATPase, Ca++ transporting, plasma membrane 3
domestic cat(101101451) ATPase, Ca++ transporting, plasma membrane 3
cow(504353) ATPase, Ca++ transporting, plasma membrane 3
naked mole-rat(101713508) ATPase, Ca++ transporting, plasma membrane 3
domestic guinea pig(100729216) ATPase, Ca++ transporting, plasma membrane 3
sheep(101101873) ATPase, Ca++ transporting, plasma membrane 3
Domestic Rabbit(100356760) ATPase, Ca++ transporting, plasma membrane 3
170 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001344 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001344 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001344 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177236 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177236 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177236 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU080941 MISSION® esiRNA esiRNA human ATP2B3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001344 Rosetta Predictions human pricing
NM_021949 Rosetta Predictions human pricing
NM_133288 Rosetta Predictions rat pricing
NM_177236 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001344 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214602 predicted 2680
2 SASI_Hs01_00214603 predicted 2757
3 SASI_Hs01_00214604 predicted 3153
4 SASI_Hs01_00214605 predicted 818
5 SASI_Hs01_00214607 predicted 364
6 SASI_Hs01_00214608 predicted 1291
7 SASI_Hs01_00214609 predicted 3159
8 SASI_Hs01_00214610 predicted 2447
9 SASI_Hs01_00214611 predicted 3163
10 SASI_Hs02_00303725 predicted 532
11 SASI_Hs01_00214606 predicted 925
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206214 predicted 2677
2 SASI_Hs01_00206215 predicted 2758
3 SASI_Hs01_00206216 predicted 3161
4 SASI_Hs01_00206217 predicted 820
5 SASI_Hs01_00206219 predicted 370
6 SASI_Hs01_00206220 predicted 1285
7 SASI_Hs01_00206221 predicted 3151
8 SASI_Hs01_00206222 predicted 2444
9 SASI_Hs01_00206223 predicted 3160
10 SASI_Hs02_00355273 predicted 537
11 SASI_Hs01_00206218 predicted 928
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267562 predicted 1870
2 SASI_Rn02_00267563 predicted 2739
3 SASI_Rn02_00267564 predicted 1270
4 SASI_Rn02_00267565 predicted 2978
5 SASI_Rn02_00267566 predicted 3474
6 SASI_Rn02_00267567 predicted 2944
7 SASI_Rn02_00267568 predicted 1957
8 SASI_Rn02_00267569 predicted 1788
9 SASI_Rn02_00267570 predicted 1774
10 SASI_Rn02_00267571 predicted 3424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096585 predicted 2685
2 SASI_Mm01_00096586 predicted 579
3 SASI_Mm01_00096587 predicted 943
4 SASI_Mm01_00096588 predicted 2653
5 SASI_Mm02_00347268 predicted 1590
6 SASI_Mm01_00096589 predicted 2665
7 SASI_Mm01_00096590 predicted 611
8 SASI_Mm01_00096591 predicted 3404
9 SASI_Mm01_00096593 predicted 3182
10 SASI_Mm01_00096594 predicted 373
11 SASI_Mm01_00096592 predicted 1511
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001344
ATP2B3 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, plasma membrane 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001344.1-4735s1c1
Sequence:CCGGGCAGGTATAATTGGAGCATTTCTCGAGAAATGCTCCAATTATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001344.1-3520s1c1
Sequence:CCGGCCAGAATCCAAGACCTCCATTCTCGAGAATGGAGGTCTTGGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001344.1-1927s1c1
Sequence:CCGGGCCTCAGAGATCCTCTTGAAACTCGAGTTTCAAGAGGATCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001344.1-1822s1c1
Sequence:CCGGCCGGAAGACAAGCTTTACAAACTCGAGTTTGTAAAGCTTGTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001344.1-1281s1c1
Sequence:CCGGCCTGGTCCTCTACTTTGTGATCTCGAGATCACAAAGTAGAGGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001344
ATP2B3 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, plasma membrane 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001344.1-4735s1c1
Sequence:CCGGGCAGGTATAATTGGAGCATTTCTCGAGAAATGCTCCAATTATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001344.1-3520s1c1
Sequence:CCGGCCAGAATCCAAGACCTCCATTCTCGAGAATGGAGGTCTTGGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001344.1-1927s1c1
Sequence:CCGGGCCTCAGAGATCCTCTTGAAACTCGAGTTTCAAGAGGATCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001344.1-1822s1c1
Sequence:CCGGCCGGAAGACAAGCTTTACAAACTCGAGTTTGTAAAGCTTGTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001344.1-1281s1c1
Sequence:CCGGCCTGGTCCTCTACTTTGTGATCTCGAGATCACAAAGTAGAGGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001344
ATP2B3 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, plasma membrane 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001344.1-4735s1c1
Sequence:CCGGGCAGGTATAATTGGAGCATTTCTCGAGAAATGCTCCAATTATACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001344.1-3520s1c1
Sequence:CCGGCCAGAATCCAAGACCTCCATTCTCGAGAATGGAGGTCTTGGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001344.1-1927s1c1
Sequence:CCGGGCCTCAGAGATCCTCTTGAAACTCGAGTTTCAAGAGGATCTCTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001344.1-1822s1c1
Sequence:CCGGCCGGAAGACAAGCTTTACAAACTCGAGTTTGTAAAGCTTGTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001344.1-1281s1c1
Sequence:CCGGCCTGGTCCTCTACTTTGTGATCTCGAGATCACAAAGTAGAGGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177236
ATP2B3 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, plasma membrane 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177236.3-947s1c1
Sequence:CCGGAGAAGTTTACTGTCATACGAACTCGAGTTCGTATGACAGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177236.3-4156s1c1
Sequence:CCGGGAAATGACTAACATGGCTAAACTCGAGTTTAGCCATGTTAGTCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177236.3-2107s1c1
Sequence:CCGGCGCAAGTCTATGAGCACAGTTCTCGAGAACTGTGCTCATAGACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177236.3-916s1c1
Sequence:CCGGCGAGGTCTTCAAAGCCGTATTCTCGAGAATACGGCTTTGAAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177236.3-1018s1c1
Sequence:CCGGGCCCAGGTCAAATATGGAGATCTCGAGATCTCCATATTTGACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177236
ATP2B3 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, plasma membrane 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177236.3-947s1c1
Sequence:CCGGAGAAGTTTACTGTCATACGAACTCGAGTTCGTATGACAGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177236.3-4156s1c1
Sequence:CCGGGAAATGACTAACATGGCTAAACTCGAGTTTAGCCATGTTAGTCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177236.3-2107s1c1
Sequence:CCGGCGCAAGTCTATGAGCACAGTTCTCGAGAACTGTGCTCATAGACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177236.3-916s1c1
Sequence:CCGGCGAGGTCTTCAAAGCCGTATTCTCGAGAATACGGCTTTGAAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177236.3-1018s1c1
Sequence:CCGGGCCCAGGTCAAATATGGAGATCTCGAGATCTCCATATTTGACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177236
ATP2B3 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, plasma membrane 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177236.3-947s1c1
Sequence:CCGGAGAAGTTTACTGTCATACGAACTCGAGTTCGTATGACAGTAAACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101550    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177236.3-4156s1c1
Sequence:CCGGGAAATGACTAACATGGCTAAACTCGAGTTTAGCCATGTTAGTCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177236.3-2107s1c1
Sequence:CCGGCGCAAGTCTATGAGCACAGTTCTCGAGAACTGTGCTCATAGACTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177236.3-916s1c1
Sequence:CCGGCGAGGTCTTCAAAGCCGTATTCTCGAGAATACGGCTTTGAAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177236.3-1018s1c1
Sequence:CCGGGCCCAGGTCAAATATGGAGATCTCGAGATCTCCATATTTGACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks