EMAIL THIS PAGE TO A FRIEND

ATP2B4

ATPase, Ca++ transporting, plasma membrane 4

323 Gene Product Result for
Synonyms: ATP2B2 MXRA1 PMCA4 PMCA4b PMCA4x
Gene ID:
Human(493) Summary: The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 4. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(381290) ATPase, Ca++ transporting, plasma membrane 4
Rat(29600) ATPase, Ca++ transporting, plasma membrane 4
Zebrafish(768304) ATPase, Ca++ transporting, plasma membrane 4
chicken(419934) ATPase, Ca++ transporting, plasma membrane 4
dog(403731) ATPase, Ca++ transporting, plasma membrane 4
Horse(100034081) ATPase, Ca++ transporting, plasma membrane 4
cow(282146) ATPase, Ca++ transporting, plasma membrane 4
Horse(100049920) ATPase, Ca++ transporting, plasma membrane 4
domestic cat(101101538) ATPase, Ca++ transporting, plasma membrane 4
Domestic Rabbit(100353865) ATPase, Ca++ transporting, plasma membrane 4
domestic guinea pig(100337639) ATPase, Ca++ transporting, plasma membrane 4
naked mole-rat(101699650) ATPase, Ca++ transporting, plasma membrane 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_213616 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_213616 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_213616 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001684 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001396 Rosetta Predictions human pricing
NM_001684 Rosetta Predictions human pricing
NM_001005871 Rosetta Predictions rat pricing
XM_579145 Rosetta Predictions rat pricing
NM_213616 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001396 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061261 predicted 2293
2 SASI_Hs01_00061262 predicted 1349
3 SASI_Hs01_00061264 predicted 2655
4 SASI_Hs01_00061265 predicted 2578
5 SASI_Hs01_00061266 predicted 3648
6 SASI_Hs01_00061267 predicted 2521
7 SASI_Hs02_00303734 predicted 2337
8 SASI_Hs01_00061268 predicted 2781
9 SASI_Hs01_00061269 predicted 2074
10 SASI_Hs01_00061270 predicted 1376
11 SASI_Hs01_00061263 predicted 3494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332338 predicted 2294
2 SASI_Hs01_00071453 predicted 1349
3 SASI_Hs01_00071455 predicted 2656
4 SASI_Hs01_00071456 predicted 2575
5 SASI_Hs01_00071457 predicted 3651
6 SASI_Hs01_00071458 predicted 2522
7 SASI_Hs02_00332339 predicted 2331
8 SASI_Hs01_00071460 predicted 2782
9 SASI_Hs01_00071461 predicted 2079
10 SASI_Hs01_00071462 predicted 1373
11 SASI_Hs01_00071454 predicted 3495
12 SASI_Hs01_00071459 predicted 4489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00031842 predicted 296
2 SASI_Rn01_00031843 predicted 2231
3 SASI_Rn01_00031844 predicted 3060
4 SASI_Rn02_00198442 predicted 3523
5 SASI_Rn01_00031845 predicted 738
6 SASI_Rn01_00031846 predicted 594
7 SASI_Rn01_00031848 predicted 1942
8 SASI_Rn01_00031849 predicted 1569
9 SASI_Rn01_00031850 predicted 625
10 SASI_Rn02_00198443 predicted 2595
11 SASI_Rn01_00031841 predicted 3537
12 SASI_Rn01_00031847 predicted 3672
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135510 predicted 2973
2 SASI_Rn01_00135511 predicted 301
3 SASI_Rn01_00135512 predicted 2228
4 SASI_Rn01_00135513 predicted 740
5 SASI_Rn01_00135514 predicted 604
6 SASI_Rn01_00135515 predicted 1954
7 SASI_Rn01_00135516 predicted 1581
8 SASI_Rn01_00135517 predicted 623
9 SASI_Rn01_00135518 predicted 2592
10 SASI_Rn01_00135519 predicted 1371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_213616 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00086802 predicted 2063
2 SASI_Mm01_00086803 predicted 2725
3 SASI_Mm02_00352295 predicted 2173
4 SASI_Mm01_00086804 predicted 1821
5 SASI_Mm01_00086805 predicted 2771
6 SASI_Mm01_00086806 predicted 265
7 SASI_Mm01_00086809 predicted 1244
8 SASI_Mm01_00086810 predicted 1891
9 SASI_Mm01_00086811 predicted 3424
10 SASI_Mm02_00352296 predicted 1524
11 SASI_Mm01_00086807 predicted 1420
12 SASI_Mm01_00086808 predicted 1647
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_213616
ATP2B4 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, plasma membrane 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-268s1c1
Sequence:CCGGCCCAAGACTTTCTTAGAATTACTCGAGTAATTCTAAGAAAGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-1858s1c1
Sequence:CCGGCGAGATAATATGGTACGCAATCTCGAGATTGCGTACCATATTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-1908s1c1
Sequence:CCGGCCGGACTATCTGCTTAGCTTACTCGAGTAAGCTAAGCAGATAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-3321s1c1
Sequence:CCGGCGTCAAACTGTTCCACAATAACTCGAGTTATTGTGGAACAGTTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-3455s1c1
Sequence:CCGGGCAATCCTGAATTGGTTTCTACTCGAGTAGAAACCAATTCAGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_213616
ATP2B4 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, plasma membrane 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-268s1c1
Sequence:CCGGCCCAAGACTTTCTTAGAATTACTCGAGTAATTCTAAGAAAGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-1858s1c1
Sequence:CCGGCGAGATAATATGGTACGCAATCTCGAGATTGCGTACCATATTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-1908s1c1
Sequence:CCGGCCGGACTATCTGCTTAGCTTACTCGAGTAAGCTAAGCAGATAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-3321s1c1
Sequence:CCGGCGTCAAACTGTTCCACAATAACTCGAGTTATTGTGGAACAGTTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-3455s1c1
Sequence:CCGGGCAATCCTGAATTGGTTTCTACTCGAGTAGAAACCAATTCAGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_213616
ATP2B4 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, plasma membrane 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-268s1c1
Sequence:CCGGCCCAAGACTTTCTTAGAATTACTCGAGTAATTCTAAGAAAGTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-1858s1c1
Sequence:CCGGCGAGATAATATGGTACGCAATCTCGAGATTGCGTACCATATTATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-1908s1c1
Sequence:CCGGCCGGACTATCTGCTTAGCTTACTCGAGTAAGCTAAGCAGATAGTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-3321s1c1
Sequence:CCGGCGTCAAACTGTTCCACAATAACTCGAGTTATTGTGGAACAGTTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_213616.1-3455s1c1
Sequence:CCGGGCAATCCTGAATTGGTTTCTACTCGAGTAGAAACCAATTCAGGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001684
VALIDATED
ATP2B4 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, plasma membrane 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001684.2-5424s1c1
Sequence:CCGGCCCTTGATTTAGTTCCAGAATCTCGAGATTCTGGAACTAAATCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001684.2-3994s1c1
Sequence:CCGGGCCAGCACTATACCATTGTTTCTCGAGAAACAATGGTATAGTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001684.2-1734s1c1
Sequence:CCGGGCTGAGATTGTGGTTGGTGATCTCGAGATCACCAACCACAATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001684.2-2255s1c1
Sequence:CCGGCCTGATTCTATACTTTGTGATCTCGAGATCACAAAGTATAGAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001684.2-3029s1c1
Sequence:CCGGCCGGACTATCTGCATAGCTTACTCGAGTAAGCTATGCAGATAGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001684.3-3754s21c1
Sequence:CCGGGCCAGCACTATACCATTGTTTCTCGAGAAACAATGGTATAGTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001684.3-1494s21c1
Sequence:CCGGGCTGAGATTGTGGTTGGTGATCTCGAGATCACCAACCACAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001684.3-999s21c1
Sequence:CCGGGATGCACTGACCCAGATTAATCTCGAGATTAATCTGGGTCAGTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001684.3-5184s21c1
Sequence:CCGGCCCTTGATTTAGTTCCAGAATCTCGAGATTCTGGAACTAAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001684.3-2333s21c1
Sequence:CCGGGGGCATCCATTACCGTCAAATCTCGAGATTTGACGGTAATGGATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001684
VALIDATED
ATP2B4 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, plasma membrane 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001684.2-5424s1c1
Sequence:CCGGCCCTTGATTTAGTTCCAGAATCTCGAGATTCTGGAACTAAATCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001684.2-3994s1c1
Sequence:CCGGGCCAGCACTATACCATTGTTTCTCGAGAAACAATGGTATAGTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001684.2-1734s1c1
Sequence:CCGGGCTGAGATTGTGGTTGGTGATCTCGAGATCACCAACCACAATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001684.2-2255s1c1
Sequence:CCGGCCTGATTCTATACTTTGTGATCTCGAGATCACAAAGTATAGAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001684.2-3029s1c1
Sequence:CCGGCCGGACTATCTGCATAGCTTACTCGAGTAAGCTATGCAGATAGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001684.3-3754s21c1
Sequence:CCGGGCCAGCACTATACCATTGTTTCTCGAGAAACAATGGTATAGTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001684.3-1494s21c1
Sequence:CCGGGCTGAGATTGTGGTTGGTGATCTCGAGATCACCAACCACAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001684.3-999s21c1
Sequence:CCGGGATGCACTGACCCAGATTAATCTCGAGATTAATCTGGGTCAGTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001684.3-5184s21c1
Sequence:CCGGCCCTTGATTTAGTTCCAGAATCTCGAGATTCTGGAACTAAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001684.3-2333s21c1
Sequence:CCGGGGGCATCCATTACCGTCAAATCTCGAGATTTGACGGTAATGGATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001684
VALIDATED
ATP2B4 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, plasma membrane 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005781    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001684.2-5424s1c1
Sequence:CCGGCCCTTGATTTAGTTCCAGAATCTCGAGATTCTGGAACTAAATCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001684.2-3994s1c1
Sequence:CCGGGCCAGCACTATACCATTGTTTCTCGAGAAACAATGGTATAGTGCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_001684.2-1734s1c1
Sequence:CCGGGCTGAGATTGTGGTTGGTGATCTCGAGATCACCAACCACAATCTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001684.2-2255s1c1
Sequence:CCGGCCTGATTCTATACTTTGTGATCTCGAGATCACAAAGTATAGAATCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001684.2-3029s1c1
Sequence:CCGGCCGGACTATCTGCATAGCTTACTCGAGTAAGCTATGCAGATAGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001684.3-3754s21c1
Sequence:CCGGGCCAGCACTATACCATTGTTTCTCGAGAAACAATGGTATAGTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001684.3-1494s21c1
Sequence:CCGGGCTGAGATTGTGGTTGGTGATCTCGAGATCACCAACCACAATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_001684.3-999s21c1
Sequence:CCGGGATGCACTGACCCAGATTAATCTCGAGATTAATCTGGGTCAGTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001684.3-5184s21c1
Sequence:CCGGCCCTTGATTTAGTTCCAGAATCTCGAGATTCTGGAACTAAATCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001684.3-2333s21c1
Sequence:CCGGGGGCATCCATTACCGTCAAATCTCGAGATTTGACGGTAATGGATGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks