EMAIL THIS PAGE TO A FRIEND

ATP2C1

ATPase, Ca++ transporting, type 2C, member 1

152 Gene Product Result for
Synonyms: ATP2C1A BCPM HHD PMR1 SPCA1 hSPCA1
Gene ID:
Human(27032) Summary: The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium ions. Defects in this gene cause Hailey-Hailey disease, an autosomal dominant disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Mouse(235574) ATPase, Ca++-sequestering
Rat(170699) ATPase, Ca++ transporting, type 2C, member 1
naked mole-rat(101707859) ATPase, Ca++ transporting, type 2C, member 1
domestic guinea pig(100724967) ATPase, Ca++ transporting, type 2C, member 1
sheep(101121651) ATPase, Ca++ transporting, type 2C, member 1
Zebrafish(559574) ATPase, Ca++ transporting, type 2C, member 1
chicken(428450) ATPase, Ca++ transporting, type 2C, member 1
dog(477066) ATPase, Ca++ transporting, type 2C, member 1
cow(327663) ATPase, Ca++ transporting, type 2C, member 1
Horse(100052698) ATPase, Ca++ transporting, type 2C, member 1
domestic cat(101095433) ATPase, Ca++ transporting, type 2C, member 1
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175025 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175025 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175025 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014382 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014382 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014382 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001485 Rosetta Predictions human pricing
NM_001001486 Rosetta Predictions human pricing
NM_001001487 Rosetta Predictions human pricing
NM_014382 Rosetta Predictions human pricing
NM_131907 Rosetta Predictions rat pricing
NM_175025 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001485 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044644 predicted 2228
2 SASI_Hs01_00044646 predicted 258
3 SASI_Hs01_00044647 predicted 1292
4 SASI_Hs02_00303792 predicted 596
5 SASI_Hs01_00044648 predicted 2579
6 SASI_Hs01_00044649 predicted 1189
7 SASI_Hs01_00044650 predicted 2306
8 SASI_Hs01_00044651 predicted 486
9 SASI_Hs01_00044652 predicted 283
10 SASI_Hs02_00303793 predicted 1136
11 SASI_Hs01_00044645 predicted 998
12 SASI_Hs01_00044653 predicted 2385
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001486 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099521 predicted 2225
2 SASI_Hs01_00099523 predicted 250
3 SASI_Hs01_00099524 predicted 1291
4 SASI_Hs02_00303794 predicted 591
5 SASI_Hs01_00099525 predicted 2575
6 SASI_Hs01_00099526 predicted 1193
7 SASI_Hs01_00099527 predicted 2300
8 SASI_Hs01_00099528 predicted 487
9 SASI_Hs01_00099529 predicted 275
10 SASI_Hs02_00303795 predicted 1131
11 SASI_Hs01_00099522 predicted 1002
12 SASI_Hs01_00099530 predicted 2384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099461 predicted 2224
2 SASI_Hs01_00099463 predicted 252
3 SASI_Hs01_00099464 predicted 1290
4 SASI_Hs02_00303796 predicted 596
5 SASI_Hs01_00099465 predicted 2574
6 SASI_Hs01_00099466 predicted 1185
7 SASI_Hs01_00099467 predicted 2303
8 SASI_Hs01_00099468 predicted 487
9 SASI_Hs01_00099469 predicted 281
10 SASI_Hs02_00303797 predicted 1136
11 SASI_Hs01_00099462 predicted 1002
12 SASI_Hs01_00099470 predicted 2386
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014382 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158016 predicted 2228
2 SASI_Hs01_00158018 predicted 252
3 SASI_Hs01_00158019 predicted 1295
4 SASI_Hs02_00345540 predicted 593
5 SASI_Hs01_00158020 predicted 2580
6 SASI_Hs01_00158021 predicted 1190
7 SASI_Hs01_00158022 predicted 2306
8 SASI_Hs01_00158023 predicted 491
9 SASI_Hs01_00158024 predicted 283
10 SASI_Hs02_00345541 predicted 1133
11 SASI_Hs01_00158017 predicted 1006
12 SASI_Hs01_00158025 predicted 2389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_131907 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054978 predicted 1594
2 SASI_Rn01_00054979 predicted 1747
3 SASI_Rn01_00054981 predicted 777
4 SASI_Rn01_00054983 predicted 2721
5 SASI_Rn01_00054984 predicted 2587
6 SASI_Rn01_00054985 predicted 2421
7 SASI_Rn01_00054986 predicted 2670
8 SASI_Rn01_00054987 predicted 982
9 SASI_Rn02_00267535 predicted 975
10 SASI_Rn02_00267536 predicted 1182
11 SASI_Rn01_00054980 predicted 2144
12 SASI_Rn01_00054982 predicted 1285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175025 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108983 predicted 690
2 SASI_Mm01_00108984 predicted 1508
3 SASI_Mm01_00108985 predicted 2430
4 SASI_Mm01_00108986 predicted 2053
5 SASI_Mm02_00345614 predicted 2878
6 SASI_Mm01_00108987 predicted 1530
7 SASI_Mm01_00108988 predicted 2585
8 SASI_Mm01_00108989 predicted 2634
9 SASI_Mm01_00108991 predicted 592
10 SASI_Mm02_00345615 predicted 881
11 SASI_Mm01_00108982 predicted 2129
12 SASI_Mm01_00108990 predicted 2507
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175025
VALIDATED
ATP2C1 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, type 2C, member 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-597s21c1
Sequence:CCGGCAGTGAAGATGAACCATTATGCTCGAGCATAATGGTTCATCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-1843s21c1
Sequence:CCGGGCTTATGAGCAGGTGATTAAGCTCGAGCTTAATCACCTGCTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-910s21c1
Sequence:CCGGCCTGCGGACTTACGCTTATTTCTCGAGAAATAAGCGTAAGTCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-3403s21c1
Sequence:CCGGATGGGCAAGTACTGAATTAAACTCGAGTTTAATTCAGTACTTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-3488s21c1
Sequence:CCGGGTCTGTCTTAGATGGATATAACTCGAGTTATATCCATCTAAGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175025.2-3535s1c1
Sequence:CCGGGCTTTCTTACTAACACACAAACTCGAGTTTGTGTGTTAGTAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175025.2-892s1c1
Sequence:CCGGCCTGCGGACTTACGCTTATTTCTCGAGAAATAAGCGTAAGTCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175025.2-2428s1c1
Sequence:CCGGCAAACCATCATGTCTGCAATACTCGAGTATTGCAGACATGATGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175025.2-2199s1c1
Sequence:CCGGCCTTTCACAGATAGTGCCAAACTCGAGTTTGGCACTATCTGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175025.2-2637s1c1
Sequence:CCGGGCCAGTGGATAAAGATGTCATCTCGAGATGACATCTTTATCCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175025
VALIDATED
ATP2C1 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, type 2C, member 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-597s21c1
Sequence:CCGGCAGTGAAGATGAACCATTATGCTCGAGCATAATGGTTCATCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-1843s21c1
Sequence:CCGGGCTTATGAGCAGGTGATTAAGCTCGAGCTTAATCACCTGCTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-910s21c1
Sequence:CCGGCCTGCGGACTTACGCTTATTTCTCGAGAAATAAGCGTAAGTCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-3403s21c1
Sequence:CCGGATGGGCAAGTACTGAATTAAACTCGAGTTTAATTCAGTACTTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-3488s21c1
Sequence:CCGGGTCTGTCTTAGATGGATATAACTCGAGTTATATCCATCTAAGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175025.2-3535s1c1
Sequence:CCGGGCTTTCTTACTAACACACAAACTCGAGTTTGTGTGTTAGTAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175025.2-892s1c1
Sequence:CCGGCCTGCGGACTTACGCTTATTTCTCGAGAAATAAGCGTAAGTCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175025.2-2428s1c1
Sequence:CCGGCAAACCATCATGTCTGCAATACTCGAGTATTGCAGACATGATGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175025.2-2199s1c1
Sequence:CCGGCCTTTCACAGATAGTGCCAAACTCGAGTTTGGCACTATCTGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175025.2-2637s1c1
Sequence:CCGGGCCAGTGGATAAAGATGTCATCTCGAGATGACATCTTTATCCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175025
VALIDATED
ATP2C1 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, type 2C, member 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375111    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-597s21c1
Sequence:CCGGCAGTGAAGATGAACCATTATGCTCGAGCATAATGGTTCATCTTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-1843s21c1
Sequence:CCGGGCTTATGAGCAGGTGATTAAGCTCGAGCTTAATCACCTGCTCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-910s21c1
Sequence:CCGGCCTGCGGACTTACGCTTATTTCTCGAGAAATAAGCGTAAGTCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-3403s21c1
Sequence:CCGGATGGGCAAGTACTGAATTAAACTCGAGTTTAATTCAGTACTTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375112    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_175025.3-3488s21c1
Sequence:CCGGGTCTGTCTTAGATGGATATAACTCGAGTTATATCCATCTAAGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101425    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175025.2-3535s1c1
Sequence:CCGGGCTTTCTTACTAACACACAAACTCGAGTTTGTGTGTTAGTAAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175025.2-892s1c1
Sequence:CCGGCCTGCGGACTTACGCTTATTTCTCGAGAAATAAGCGTAAGTCCGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175025.2-2428s1c1
Sequence:CCGGCAAACCATCATGTCTGCAATACTCGAGTATTGCAGACATGATGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101429    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175025.2-2199s1c1
Sequence:CCGGCCTTTCACAGATAGTGCCAAACTCGAGTTTGGCACTATCTGTGAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_175025.2-2637s1c1
Sequence:CCGGGCCAGTGGATAAAGATGTCATCTCGAGATGACATCTTTATCCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014382
VALIDATED
ATP2C1 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, type 2C, member 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014382.2-688s21c1
Sequence:CCGGCCTGCTGACTTACGCTTGTTTCTCGAGAAACAAGCGTAAGTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014382.2-1303s21c1
Sequence:CCGGGTTACTGGAGTTGGCTATAATCTCGAGATTATAGCCAACTCCAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014382.2-3116s21c1
Sequence:CCGGTGCAACTTTGATATCATATTCCTCGAGGAATATGATATCAAAGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014382.2-1205s21c1
Sequence:CCGGGCTGCTGTAATGTGATTTGTTCTCGAGAACAAATCACATTACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014382.2-2437s21c1
Sequence:CCGGCCAGTGGATAAAGATGTCATTCTCGAGAATGACATCTTTATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014382.1-2358s1c1
Sequence:CCGGGCACGAGTATAGCAGCATTAACTCGAGTTAATGCTGCTATACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014382.1-1260s1c1
Sequence:CCGGGCTGCTGTAATGTGATTTGTTCTCGAGAACAAATCACATTACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014382.1-2492s1c1
Sequence:CCGGCCAGTGGATAAAGATGTCATTCTCGAGAATGACATCTTTATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014382.1-544s1c1
Sequence:CCGGCGTCAGTATCACTGTGGCAATCTCGAGATTGCCACAGTGATACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014382
VALIDATED
ATP2C1 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, type 2C, member 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014382.2-688s21c1
Sequence:CCGGCCTGCTGACTTACGCTTGTTTCTCGAGAAACAAGCGTAAGTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014382.2-1303s21c1
Sequence:CCGGGTTACTGGAGTTGGCTATAATCTCGAGATTATAGCCAACTCCAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014382.2-3116s21c1
Sequence:CCGGTGCAACTTTGATATCATATTCCTCGAGGAATATGATATCAAAGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014382.2-1205s21c1
Sequence:CCGGGCTGCTGTAATGTGATTTGTTCTCGAGAACAAATCACATTACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014382.2-2437s21c1
Sequence:CCGGCCAGTGGATAAAGATGTCATTCTCGAGAATGACATCTTTATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014382.1-2358s1c1
Sequence:CCGGGCACGAGTATAGCAGCATTAACTCGAGTTAATGCTGCTATACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014382.1-1260s1c1
Sequence:CCGGGCTGCTGTAATGTGATTTGTTCTCGAGAACAAATCACATTACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014382.1-2492s1c1
Sequence:CCGGCCAGTGGATAAAGATGTCATTCTCGAGAATGACATCTTTATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014382.1-544s1c1
Sequence:CCGGCGTCAGTATCACTGTGGCAATCTCGAGATTGCCACAGTGATACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014382
VALIDATED
ATP2C1 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, type 2C, member 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291213    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_014382.2-688s21c1
Sequence:CCGGCCTGCTGACTTACGCTTGTTTCTCGAGAAACAAGCGTAAGTCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296815    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014382.2-1303s21c1
Sequence:CCGGGTTACTGGAGTTGGCTATAATCTCGAGATTATAGCCAACTCCAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014382.2-3116s21c1
Sequence:CCGGTGCAACTTTGATATCATATTCCTCGAGGAATATGATATCAAAGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014382.2-1205s21c1
Sequence:CCGGGCTGCTGTAATGTGATTTGTTCTCGAGAACAAATCACATTACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014382.2-2437s21c1
Sequence:CCGGCCAGTGGATAAAGATGTCATTCTCGAGAATGACATCTTTATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014382.1-2358s1c1
Sequence:CCGGGCACGAGTATAGCAGCATTAACTCGAGTTAATGCTGCTATACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014382.1-1260s1c1
Sequence:CCGGGCTGCTGTAATGTGATTTGTTCTCGAGAACAAATCACATTACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014382.1-2492s1c1
Sequence:CCGGCCAGTGGATAAAGATGTCATTCTCGAGAATGACATCTTTATCCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014382.1-544s1c1
Sequence:CCGGCGTCAGTATCACTGTGGCAATCTCGAGATTGCCACAGTGATACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks