EMAIL THIS PAGE TO A FRIEND

ATP2C2

ATPase, Ca++ transporting, type 2C, member 2

65 Gene Product Result for
Synonyms: SPCA2
UniProtKB ID: O75185, B4DU76, Q5S053, Q68CQ2
Gene ID:
Mouse(69047) ATPase, Ca++ transporting, type 2C, member 2
Rat(171496) ATPase, Ca++ transporting, type 2C, member 2
chicken(100859316) ATPase, Ca++ transporting, type 2C, member 2
cow(510329) ATPase, Ca++ transporting, type 2C, member 2
Horse(100070166) ATPase, Ca++ transporting, type 2C, member 2
domestic cat(101088898) ATPase, Ca++ transporting, type 2C, member 2
dog(479626) ATPase, Ca++ transporting, type 2C, member 2
sheep(101123576) ATPase, Ca++ transporting, type 2C, member 2
domestic guinea pig(100730393) ATPase, Ca++ transporting, type 2C, member 2
naked mole-rat(101711379) ATPase, Ca++ transporting, type 2C, member 2
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014861 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014861 Rosetta Predictions human pricing
NM_134462 Rosetta Predictions rat pricing
NM_026922 Rosetta Predictions mouse pricing
XM_486167 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346441 predicted 1690
2 SASI_Hs02_00346442 predicted 1813
3 SASI_Hs01_00117382 predicted 1342
4 SASI_Hs02_00346443 predicted 2196
5 SASI_Hs02_00346444 predicted 272
6 SASI_Hs01_00117383 predicted 353
7 SASI_Hs01_00117384 predicted 2955
8 SASI_Hs02_00346445 predicted 2216
9 SASI_Hs01_00117385 predicted 1312
10 SASI_Hs02_00346446 predicted 1569
11 SASI_Hs01_00117378 predicted 2002
12 SASI_Hs01_00117379 predicted 1380
13 SASI_Hs01_00117380 predicted 1439
14 SASI_Hs01_00117381 predicted 799
15 SASI_Hs01_00117386 predicted 1295
16 SASI_Hs01_00117387 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134462 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101604 predicted 719
2 SASI_Rn01_00101605 predicted 2680
3 SASI_Rn01_00101606 predicted 1357
4 SASI_Rn01_00101607 predicted 1699
5 SASI_Rn01_00101608 predicted 718
6 SASI_Rn01_00101609 predicted 1595
7 SASI_Rn01_00101610 predicted 2514
8 SASI_Rn01_00101611 predicted 2219
9 SASI_Rn01_00101612 predicted 1494
10 SASI_Rn01_00101613 predicted 2710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331200 predicted 1409
2 SASI_Mm02_00331201 predicted 713
3 SASI_Mm02_00331202 predicted 2993
4 SASI_Mm02_00331203 predicted 2730
5 SASI_Mm02_00331204 predicted 2255
6 SASI_Mm02_00331205 predicted 1659
7 SASI_Mm02_00331206 predicted 1546
8 SASI_Mm02_00331207 predicted 1209
9 SASI_Mm02_00331208 predicted 1265
10 SASI_Mm02_00331209 predicted 1701
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486167 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00231421 predicted 1655
2 SASI_Mm01_00231422 predicted 964
3 SASI_Mm01_00231423 predicted 3248
4 SASI_Mm01_00231424 predicted 2981
5 SASI_Mm01_00231425 predicted 2496
6 SASI_Mm01_00231426 predicted 1902
7 SASI_Mm01_00231427 predicted 1801
8 SASI_Mm01_00231428 predicted 1459
9 SASI_Mm01_00231429 predicted 1514
10 SASI_Mm01_00231430 predicted 1839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014861
ATP2C2 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, type 2C, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014861.1-3357s1c1
Sequence:CCGGCCTAATCATCTCGATCTGGTTCTCGAGAACCAGATCGAGATGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014861.1-1563s1c1
Sequence:CCGGCGGGTCATCGTGAAGAAGTTACTCGAGTAACTTCTTCACGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014861.1-1301s1c1
Sequence:CCGGCGGAGAAGTGTTTAAGATGATCTCGAGATCATCTTAAACACTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014861.1-787s1c1
Sequence:CCGGGCGAACCTGTGTGGAAGAAATCTCGAGATTTCTTCCACACAGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014861.1-3077s1c1
Sequence:CCGGGCTGATATTTGAGATCGGCTTCTCGAGAAGCCGATCTCAAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014861
ATP2C2 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, type 2C, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014861.1-3357s1c1
Sequence:CCGGCCTAATCATCTCGATCTGGTTCTCGAGAACCAGATCGAGATGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014861.1-1563s1c1
Sequence:CCGGCGGGTCATCGTGAAGAAGTTACTCGAGTAACTTCTTCACGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014861.1-1301s1c1
Sequence:CCGGCGGAGAAGTGTTTAAGATGATCTCGAGATCATCTTAAACACTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014861.1-787s1c1
Sequence:CCGGGCGAACCTGTGTGGAAGAAATCTCGAGATTTCTTCCACACAGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014861.1-3077s1c1
Sequence:CCGGGCTGATATTTGAGATCGGCTTCTCGAGAAGCCGATCTCAAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014861
ATP2C2 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, type 2C, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050388    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014861.1-3357s1c1
Sequence:CCGGCCTAATCATCTCGATCTGGTTCTCGAGAACCAGATCGAGATGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014861.1-1563s1c1
Sequence:CCGGCGGGTCATCGTGAAGAAGTTACTCGAGTAACTTCTTCACGATGACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014861.1-1301s1c1
Sequence:CCGGCGGAGAAGTGTTTAAGATGATCTCGAGATCATCTTAAACACTTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014861.1-787s1c1
Sequence:CCGGGCGAACCTGTGTGGAAGAAATCTCGAGATTTCTTCCACACAGGTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014861.1-3077s1c1
Sequence:CCGGGCTGATATTTGAGATCGGCTTCTCGAGAAGCCGATCTCAAATATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026922
ATP2C2 MISSION shRNA Bacterial Glycerol Stock
ATPase, Ca++ transporting, type 2C, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000254228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026922.1-3052s21c1
Sequence:CCGGCATCCATCTGTACTAACCACTCTCGAGAGTGGTTAGTACAGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026922.1-1297s21c1
Sequence:CCGGACTCTGACAGCCAACGAAATGCTCGAGCATTTCGTTGGCTGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026922.1-1920s21c1
Sequence:CCGGTGAGTCTGGTGTGTCGGTTAACTCGAGTTAACCGACACACCAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026922.1-413s21c1
Sequence:CCGGTCCATGGGTGGAACGAGTTTGCTCGAGCAAACTCGTTCCACCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026922.1-1488s21c1
Sequence:CCGGCATCAGGAAGAACGCCGTAATCTCGAGATTACGGCGTTCTTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026922
ATP2C2 MISSION shRNA shRNA Plasmid DNA
ATPase, Ca++ transporting, type 2C, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000254228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026922.1-3052s21c1
Sequence:CCGGCATCCATCTGTACTAACCACTCTCGAGAGTGGTTAGTACAGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026922.1-1297s21c1
Sequence:CCGGACTCTGACAGCCAACGAAATGCTCGAGCATTTCGTTGGCTGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026922.1-1920s21c1
Sequence:CCGGTGAGTCTGGTGTGTCGGTTAACTCGAGTTAACCGACACACCAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026922.1-413s21c1
Sequence:CCGGTCCATGGGTGGAACGAGTTTGCTCGAGCAAACTCGTTCCACCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026922.1-1488s21c1
Sequence:CCGGCATCAGGAAGAACGCCGTAATCTCGAGATTACGGCGTTCTTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026922
ATP2C2 MISSION shRNA Lentiviral Transduction Particles
ATPase, Ca++ transporting, type 2C, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000254228    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026922.1-3052s21c1
Sequence:CCGGCATCCATCTGTACTAACCACTCTCGAGAGTGGTTAGTACAGATGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254229    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026922.1-1297s21c1
Sequence:CCGGACTCTGACAGCCAACGAAATGCTCGAGCATTTCGTTGGCTGTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026922.1-1920s21c1
Sequence:CCGGTGAGTCTGGTGTGTCGGTTAACTCGAGTTAACCGACACACCAGACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026922.1-413s21c1
Sequence:CCGGTCCATGGGTGGAACGAGTTTGCTCGAGCAAACTCGTTCCACCCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254230    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026922.1-1488s21c1
Sequence:CCGGCATCAGGAAGAACGCCGTAATCTCGAGATTACGGCGTTCTTCCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks