EMAIL THIS PAGE TO A FRIEND

ATP4B

ATPase, H+/K+ exchanging, beta polypeptide

59 Gene Product Result for
Synonyms: ATP6B
UniProtKB ID: P51164, B1B0N8
Gene ID:
Human(496) Summary: The protein encoded by this gene belongs to a family of P-type cation-transporting ATPases. The gastric H+, K+-ATPase is a heterodimer consisting of a high molecular weight catalytic alpha subunit and a smaller but heavily glycosylated beta subunit. This enzyme is a proton pump that catalyzes the hydrolysis of ATP coupled with the exchange of H(+) and K(+) ions across the plasma membrane. It is also responsible for gastric acid secretion. This gene encodes the beta subunit of the gastric H+, K+-ATPase. [provided by RefSeq, Jul 2008]
Mouse(11945) ATPase, H+/K+ exchanging, beta polypeptide
Rat(24217) ATPase, H+/K+ exchanging, beta polypeptide
Domestic Rabbit(100009125) ATPase, H+/K+ exchanging, beta polypeptide
domestic guinea pig(100731685) ATPase, H+/K+ exchanging, beta polypeptide
naked mole-rat(101697924) ATPase, H+/K+ exchanging, beta polypeptide
chicken(386581) ATPase, H+/K+ exchanging, beta polypeptide
domestic cat(101092078) ATPase, H+/K+ exchanging, beta polypeptide
dog(404020) ATPase, H+/K+ exchanging, beta polypeptide
cow(614308) ATPase, H+/K+ exchanging, beta polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
A9360 Anti-ATP4B (271-285) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
A9235 Anti-ATP4B (66-80) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405499 Anti-ATP4B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA052649 Anti-ATP4B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2103192 Anti-ATP4B antibody produced in rabbit affinity isolated antibody pig, rabbit, mouse, rat, rabbit, canine, human, bovine, zebrafish, horse, guinea pig
western blot pricing
HPA045400 Anti-ATP4B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2106674 Anti-ATP4B antibody produced in rabbit affinity isolated antibody horse, rabbit, rat, human, guinea pig
ELISA, western blot pricing
SAB1410857 Anti-ATP4B antibody produced in rabbit purified immunoglobulin, buffered aqueous solution mouse, human
ELISA, western blot pricing
SAB1402123 Monoclonal Anti-ATP4B antibody produced in mouse clone 1D10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
A274 Monoclonal Anti-H+/K+ ATPase (β Subunit) antibody produced in mouse clone 2G11, ascites fluid, buffered aqueous solution rabbit, ferret, rat, bovine, mouse, canine, pig
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009724 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009724 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009724 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000705 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000705 Rosetta Predictions human pricing
NM_012510 Rosetta Predictions rat pricing
NM_009724 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029208 predicted 318
2 SASI_Hs01_00029210 predicted 436
3 SASI_Hs01_00029211 predicted 208
4 SASI_Hs01_00029212 predicted 900
5 SASI_Hs01_00029213 predicted 1032
6 SASI_Hs01_00029214 predicted 781
7 SASI_Hs01_00029215 predicted 710
8 SASI_Hs01_00029217 predicted 978
9 SASI_Hs02_00303107 predicted 700
10 SASI_Hs02_00303108 predicted 877
11 SASI_Hs01_00029209 predicted 197
12 SASI_Hs01_00029216 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012510 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090474 predicted 692
2 SASI_Rn01_00090475 predicted 960
3 SASI_Rn01_00090476 predicted 553
4 SASI_Rn01_00090477 predicted 305
5 SASI_Rn02_00259562 predicted 1102
6 SASI_Rn01_00090478 predicted 1234
7 SASI_Rn01_00090479 predicted 217
8 SASI_Rn01_00090480 predicted 1026
9 SASI_Rn01_00090481 predicted 379
10 SASI_Rn01_00090482 predicted 607
11 SASI_Rn01_00090473 predicted 331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009724 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079829 predicted 698
2 SASI_Mm01_00079830 predicted 230
3 SASI_Mm02_00316880 predicted 362
4 SASI_Mm01_00079831 predicted 398
5 SASI_Mm01_00079832 predicted 269
6 SASI_Mm01_00079834 predicted 400
7 SASI_Mm01_00079835 predicted 295
8 SASI_Mm01_00079836 predicted 235
9 SASI_Mm01_00079838 predicted 945
10 SASI_Mm02_00316881 predicted 1057
11 SASI_Mm01_00079833 predicted 1077
12 SASI_Mm01_00079837 predicted 962
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009724
ATP4B MISSION shRNA Bacterial Glycerol Stock
ATPase, H+/K+ exchanging, beta polypeptide
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000194578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009724.1-148s1c1
Sequence:CCGGCCTGTACTACGCAGGTTTCTACTCGAGTAGAAACCTGCGTAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009724.1-550s1c1
Sequence:CCGGGAAGCCCTGCTTCATTATTAACTCGAGTTAATAATGAAGCAGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009724.1-871s1c1
Sequence:CCGGCGAAGGGAAGGTGGAGTTTAACTCGAGTTAAACTCCACCTTCCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009724.2-703s21c1
Sequence:CCGGCACCTTCAGTCTCCACTATTTCTCGAGAAATAGTGGAGACTGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009724.2-881s21c1
Sequence:CCGGGTGGAGTTTAAACTTACAATACTCGAGTATTGTAAGTTTAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009724.2-1142s21c1
Sequence:CCGGAGGCCTATCTGTCCACATTTCCTCGAGGAAATGTGGACAGATAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009724.2-238s21c1
Sequence:CCGGAGACTACCAGGACCAGTTAAACTCGAGTTTAACTGGTCCTGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009724.2-186s21c1
Sequence:CCGGTCTTTGCCTTGTGCATCTATGCTCGAGCATAGATGCACAAGGCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009724
ATP4B MISSION shRNA shRNA Plasmid DNA
ATPase, H+/K+ exchanging, beta polypeptide
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000194578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009724.1-148s1c1
Sequence:CCGGCCTGTACTACGCAGGTTTCTACTCGAGTAGAAACCTGCGTAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009724.1-550s1c1
Sequence:CCGGGAAGCCCTGCTTCATTATTAACTCGAGTTAATAATGAAGCAGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009724.1-871s1c1
Sequence:CCGGCGAAGGGAAGGTGGAGTTTAACTCGAGTTAAACTCCACCTTCCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009724.2-703s21c1
Sequence:CCGGCACCTTCAGTCTCCACTATTTCTCGAGAAATAGTGGAGACTGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009724.2-881s21c1
Sequence:CCGGGTGGAGTTTAAACTTACAATACTCGAGTATTGTAAGTTTAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009724.2-1142s21c1
Sequence:CCGGAGGCCTATCTGTCCACATTTCCTCGAGGAAATGTGGACAGATAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009724.2-238s21c1
Sequence:CCGGAGACTACCAGGACCAGTTAAACTCGAGTTTAACTGGTCCTGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009724.2-186s21c1
Sequence:CCGGTCTTTGCCTTGTGCATCTATGCTCGAGCATAGATGCACAAGGCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009724
ATP4B MISSION shRNA Lentiviral Transduction Particles
ATPase, H+/K+ exchanging, beta polypeptide
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000194578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009724.1-148s1c1
Sequence:CCGGCCTGTACTACGCAGGTTTCTACTCGAGTAGAAACCTGCGTAGTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009724.1-550s1c1
Sequence:CCGGGAAGCCCTGCTTCATTATTAACTCGAGTTAATAATGAAGCAGGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173842    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009724.1-871s1c1
Sequence:CCGGCGAAGGGAAGGTGGAGTTTAACTCGAGTTAAACTCCACCTTCCCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009724.2-703s21c1
Sequence:CCGGCACCTTCAGTCTCCACTATTTCTCGAGAAATAGTGGAGACTGAAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246743    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009724.2-881s21c1
Sequence:CCGGGTGGAGTTTAAACTTACAATACTCGAGTATTGTAAGTTTAAACTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246742    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009724.2-1142s21c1
Sequence:CCGGAGGCCTATCTGTCCACATTTCCTCGAGGAAATGTGGACAGATAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009724.2-238s21c1
Sequence:CCGGAGACTACCAGGACCAGTTAAACTCGAGTTTAACTGGTCCTGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246740    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009724.2-186s21c1
Sequence:CCGGTCTTTGCCTTGTGCATCTATGCTCGAGCATAGATGCACAAGGCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000705
ATP4B MISSION shRNA Bacterial Glycerol Stock
ATPase, H+/K+ exchanging, beta polypeptide
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-523s1c1
Sequence:CCGGGATATGCTGCAGAACTGCTCACTCGAGTGAGCAGTTCTGCAGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-603s1c1
Sequence:CCGGGAACAGGATCGTCAAGTTCCTCTCGAGAGGAACTTGACGATCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-897s1c1
Sequence:CCGGGAAAGTGGAGTTCAAACTCAACTCGAGTTGAGTTTGAACTCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-337s1c1
Sequence:CCGGGAAATTGTCTACAACGTCTCTCTCGAGAGAGACGTTGTAGACAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000705.1-856s1c1
Sequence:CCGGGAGCACGTGACCTTCAACAATCTCGAGATTGTTGAAGGTCACGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-553s1c1
Sequence:CCGGGATCCCAACTTCGGCTTTGAACTCGAGTTCAAAGCCGAAGTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000705.2-287s21c1
Sequence:CCGGTAACCTTAAGGCCGGATGTTTCTCGAGAAACATCCGGCCTTAAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000705.2-1322s21c1
Sequence:CCGGTGAAACACGGCTTACACTAATCTCGAGATTAGTGTAAGCCGTGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000705.2-1190s21c1
Sequence:CCGGCTCTAATTAACCAGGTCATAACTCGAGTTATGACCTGGTTAATTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000705
ATP4B MISSION shRNA shRNA Plasmid DNA
ATPase, H+/K+ exchanging, beta polypeptide
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-523s1c1
Sequence:CCGGGATATGCTGCAGAACTGCTCACTCGAGTGAGCAGTTCTGCAGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-603s1c1
Sequence:CCGGGAACAGGATCGTCAAGTTCCTCTCGAGAGGAACTTGACGATCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-897s1c1
Sequence:CCGGGAAAGTGGAGTTCAAACTCAACTCGAGTTGAGTTTGAACTCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-337s1c1
Sequence:CCGGGAAATTGTCTACAACGTCTCTCTCGAGAGAGACGTTGTAGACAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000705.1-856s1c1
Sequence:CCGGGAGCACGTGACCTTCAACAATCTCGAGATTGTTGAAGGTCACGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-553s1c1
Sequence:CCGGGATCCCAACTTCGGCTTTGAACTCGAGTTCAAAGCCGAAGTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000705.2-287s21c1
Sequence:CCGGTAACCTTAAGGCCGGATGTTTCTCGAGAAACATCCGGCCTTAAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000705.2-1322s21c1
Sequence:CCGGTGAAACACGGCTTACACTAATCTCGAGATTAGTGTAAGCCGTGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000705.2-1190s21c1
Sequence:CCGGCTCTAATTAACCAGGTCATAACTCGAGTTATGACCTGGTTAATTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000705
ATP4B MISSION shRNA Lentiviral Transduction Particles
ATPase, H+/K+ exchanging, beta polypeptide
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-523s1c1
Sequence:CCGGGATATGCTGCAGAACTGCTCACTCGAGTGAGCAGTTCTGCAGCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-603s1c1
Sequence:CCGGGAACAGGATCGTCAAGTTCCTCTCGAGAGGAACTTGACGATCCTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-897s1c1
Sequence:CCGGGAAAGTGGAGTTCAAACTCAACTCGAGTTGAGTTTGAACTCCACTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-337s1c1
Sequence:CCGGGAAATTGTCTACAACGTCTCTCTCGAGAGAGACGTTGTAGACAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_000705.1-856s1c1
Sequence:CCGGGAGCACGTGACCTTCAACAATCTCGAGATTGTTGAAGGTCACGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000705.1-553s1c1
Sequence:CCGGGATCCCAACTTCGGCTTTGAACTCGAGTTCAAAGCCGAAGTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000705.2-287s21c1
Sequence:CCGGTAACCTTAAGGCCGGATGTTTCTCGAGAAACATCCGGCCTTAAGGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429149    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000705.2-1322s21c1
Sequence:CCGGTGAAACACGGCTTACACTAATCTCGAGATTAGTGTAAGCCGTGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000705.2-1190s21c1
Sequence:CCGGCTCTAATTAACCAGGTCATAACTCGAGTTATGACCTGGTTAATTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks