EMAIL THIS PAGE TO A FRIEND

ATP5A1

ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle

72 Gene Product Result for
Synonyms: ATP5A ATP5AL2 ATPM MC5DN4 MOM2 OMR ORM hATP1
Gene ID:
Human(498) Summary: This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, using an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the alpha subunit of the catalytic core. Alternatively spliced transcript variants encoding the different isoforms have been identified. Pseudogenes of this gene are located on chromosomes 9, 2, and 16. [provided by RefSeq, Mar 2012]
Mouse(11946) ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1
Rat(65262) ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Zebrafish(553755) ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
chicken(374159) ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
dog(480149) ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Horse(100053178) ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
cow(282578) ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
domestic cat(101101674) ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
naked mole-rat(101705806) ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
domestic guinea pig(100729830) ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Goat(100861332) ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
sheep(101111413) ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004046 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004046 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004046 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001937 Rosetta Predictions human pricing
NM_004046 Rosetta Predictions human pricing
NM_023093 Rosetta Predictions rat pricing
NM_007505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001937 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119735 predicted 348
2 SASI_Hs01_00119736 predicted 359
3 SASI_Hs02_00304020 predicted 1051
4 SASI_Hs01_00119738 predicted 550
5 SASI_Hs01_00119739 predicted 805
6 SASI_Hs01_00119741 predicted 322
7 SASI_Hs02_00304021 predicted 1379
8 SASI_Hs01_00119742 predicted 1441
9 SASI_Hs01_00119743 predicted 300
10 SASI_Hs02_00304022 predicted 1072
11 SASI_Hs01_00119737 predicted 1279
12 SASI_Hs01_00119740 predicted 464
13 SASI_Hs01_00119744 predicted 1657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004046 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112974 predicted 290
2 SASI_Hs01_00112975 predicted 298
3 SASI_Hs02_00336802 predicted 995
4 SASI_Hs01_00112977 predicted 495
5 SASI_Hs01_00112978 predicted 753
6 SASI_Hs01_00112980 predicted 265
7 SASI_Hs02_00336803 predicted 1316
8 SASI_Hs01_00112981 predicted 1386
9 SASI_Hs01_00112982 predicted 241
10 SASI_Hs02_00336804 predicted 1022
11 SASI_Hs01_00112976 predicted 1220
12 SASI_Hs01_00112979 predicted 412
13 SASI_Hs01_00112983 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023093 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081083 predicted 965
2 SASI_Rn02_00263725 predicted 1099
3 SASI_Rn01_00081084 predicted 266
4 SASI_Rn01_00081085 predicted 417
5 SASI_Rn01_00081086 predicted 406
6 SASI_Rn01_00081087 predicted 1465
7 SASI_Rn01_00081088 predicted 1128
8 SASI_Rn01_00081089 predicted 230
9 SASI_Rn02_00263726 predicted 1126
10 SASI_Rn01_00081090 predicted 356
11 SASI_Rn01_00081091 predicted 999
12 SASI_Rn01_00081092 predicted 415
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139653 predicted 562
2 SASI_Mm01_00139654 predicted 1902
3 SASI_Mm01_00139655 predicted 2016
4 SASI_Mm01_00139656 predicted 1338
5 SASI_Mm01_00139657 predicted 1793
6 SASI_Mm01_00139658 predicted 497
7 SASI_Mm01_00139661 predicted 1699
8 SASI_Mm01_00139662 predicted 1364
9 SASI_Mm02_00311787 predicted 584
10 SASI_Mm02_00311788 predicted 1876
11 SASI_Mm01_00139659 predicted 328
12 SASI_Mm01_00139660 predicted 1549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007505
VALIDATED
ATP5A1 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007505.2-500s21c1
Sequence:CCGGCGTGTGTTAAGCATTGGTGATCTCGAGATCACCAATGCTTAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007505.2-740s21c1
Sequence:CCGGGCCCTCGGTAATGCTATTGATCTCGAGATCAATAGCATTACCGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007505.2-1739s21c1
Sequence:CCGGGCTGTTATCTATGCGGGTGTACTCGAGTACACCCGCATAGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007505.2-1340s21c1
Sequence:CCGGGCCAAGATGAACGATTCCTTTCTCGAGAAAGGAATCGTTCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-1923s1c1
Sequence:CCGGCCGGGAATTTAATGCAGGTTTCTCGAGAAACCTGCATTAAATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-495s1c1
Sequence:CCGGGCCCTCGGTAATGCTATTGATCTCGAGATCAATAGCATTACCGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-255s1c1
Sequence:CCGGCGTGTGTTAAGCATTGGTGATCTCGAGATCACCAATGCTTAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-1494s1c1
Sequence:CCGGGCTGTTATCTATGCGGGTGTACTCGAGTACACCCGCATAGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-1095s1c1
Sequence:CCGGGCCAAGATGAACGATTCCTTTCTCGAGAAAGGAATCGTTCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007505
VALIDATED
ATP5A1 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007505.2-500s21c1
Sequence:CCGGCGTGTGTTAAGCATTGGTGATCTCGAGATCACCAATGCTTAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007505.2-740s21c1
Sequence:CCGGGCCCTCGGTAATGCTATTGATCTCGAGATCAATAGCATTACCGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007505.2-1739s21c1
Sequence:CCGGGCTGTTATCTATGCGGGTGTACTCGAGTACACCCGCATAGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007505.2-1340s21c1
Sequence:CCGGGCCAAGATGAACGATTCCTTTCTCGAGAAAGGAATCGTTCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-1923s1c1
Sequence:CCGGCCGGGAATTTAATGCAGGTTTCTCGAGAAACCTGCATTAAATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-495s1c1
Sequence:CCGGGCCCTCGGTAATGCTATTGATCTCGAGATCAATAGCATTACCGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-255s1c1
Sequence:CCGGCGTGTGTTAAGCATTGGTGATCTCGAGATCACCAATGCTTAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-1494s1c1
Sequence:CCGGGCTGTTATCTATGCGGGTGTACTCGAGTACACCCGCATAGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-1095s1c1
Sequence:CCGGGCCAAGATGAACGATTCCTTTCTCGAGAAAGGAATCGTTCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007505
VALIDATED
ATP5A1 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007505.2-500s21c1
Sequence:CCGGCGTGTGTTAAGCATTGGTGATCTCGAGATCACCAATGCTTAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007505.2-740s21c1
Sequence:CCGGGCCCTCGGTAATGCTATTGATCTCGAGATCAATAGCATTACCGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007505.2-1739s21c1
Sequence:CCGGGCTGTTATCTATGCGGGTGTACTCGAGTACACCCGCATAGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007505.2-1340s21c1
Sequence:CCGGGCCAAGATGAACGATTCCTTTCTCGAGAAAGGAATCGTTCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076238    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-1923s1c1
Sequence:CCGGCCGGGAATTTAATGCAGGTTTCTCGAGAAACCTGCATTAAATTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-495s1c1
Sequence:CCGGGCCCTCGGTAATGCTATTGATCTCGAGATCAATAGCATTACCGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076242    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-255s1c1
Sequence:CCGGCGTGTGTTAAGCATTGGTGATCTCGAGATCACCAATGCTTAACACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-1494s1c1
Sequence:CCGGGCTGTTATCTATGCGGGTGTACTCGAGTACACCCGCATAGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_007505.1-1095s1c1
Sequence:CCGGGCCAAGATGAACGATTCCTTTCTCGAGAAAGGAATCGTTCATCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004046
VALIDATED
ATP5A1 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-203s21c1
Sequence:CCGGCCTCTAACACTCATCTTCAAACTCGAGTTTGAAGATGAGTGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-281s21c1
Sequence:CCGGCCTCTGTTGATCTTGAAGAAACTCGAGTTTCTTCAAGATCAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-781s21c1
Sequence:CCGGCGTTTCAATGATGGATCTGATCTCGAGATCAGATCCATCATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-1222s21c1
Sequence:CCGGTCTGCTTACATTCCAACAAATCTCGAGATTTGTTGGAATGTAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-619s21c1
Sequence:CCGGCCCGGTATCATTCCTCGAATTCTCGAGAATTCGAGGAATGATACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004046.3-587s1c1
Sequence:CCGGCCCGGTATCATTCCTCGAATTCTCGAGAATTCGAGGAATGATACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004046.3-749s1c1
Sequence:CCGGCGTTTCAATGATGGATCTGATCTCGAGATCAGATCCATCATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004046.3-171s1c1
Sequence:CCGGCCTCTAACACTCATCTTCAAACTCGAGTTTGAAGATGAGTGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004046.3-1190s1c1
Sequence:CCGGTCTGCTTACATTCCAACAAATCTCGAGATTTGTTGGAATGTAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004046.3-249s1c1
Sequence:CCGGCCTCTGTTGATCTTGAAGAAACTCGAGTTTCTTCAAGATCAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004046
VALIDATED
ATP5A1 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-203s21c1
Sequence:CCGGCCTCTAACACTCATCTTCAAACTCGAGTTTGAAGATGAGTGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-281s21c1
Sequence:CCGGCCTCTGTTGATCTTGAAGAAACTCGAGTTTCTTCAAGATCAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-781s21c1
Sequence:CCGGCGTTTCAATGATGGATCTGATCTCGAGATCAGATCCATCATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-1222s21c1
Sequence:CCGGTCTGCTTACATTCCAACAAATCTCGAGATTTGTTGGAATGTAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-619s21c1
Sequence:CCGGCCCGGTATCATTCCTCGAATTCTCGAGAATTCGAGGAATGATACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004046.3-587s1c1
Sequence:CCGGCCCGGTATCATTCCTCGAATTCTCGAGAATTCGAGGAATGATACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004046.3-749s1c1
Sequence:CCGGCGTTTCAATGATGGATCTGATCTCGAGATCAGATCCATCATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004046.3-171s1c1
Sequence:CCGGCCTCTAACACTCATCTTCAAACTCGAGTTTGAAGATGAGTGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004046.3-1190s1c1
Sequence:CCGGTCTGCTTACATTCCAACAAATCTCGAGATTTGTTGGAATGTAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004046.3-249s1c1
Sequence:CCGGCCTCTGTTGATCTTGAAGAAACTCGAGTTTCTTCAAGATCAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004046
VALIDATED
ATP5A1 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-203s21c1
Sequence:CCGGCCTCTAACACTCATCTTCAAACTCGAGTTTGAAGATGAGTGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-281s21c1
Sequence:CCGGCCTCTGTTGATCTTGAAGAAACTCGAGTTTCTTCAAGATCAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-781s21c1
Sequence:CCGGCGTTTCAATGATGGATCTGATCTCGAGATCAGATCCATCATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300385    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-1222s21c1
Sequence:CCGGTCTGCTTACATTCCAACAAATCTCGAGATTTGTTGGAATGTAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004046.4-619s21c1
Sequence:CCGGCCCGGTATCATTCCTCGAATTCTCGAGAATTCGAGGAATGATACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004046.3-587s1c1
Sequence:CCGGCCCGGTATCATTCCTCGAATTCTCGAGAATTCGAGGAATGATACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004046.3-749s1c1
Sequence:CCGGCGTTTCAATGATGGATCTGATCTCGAGATCAGATCCATCATTGAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_004046.3-171s1c1
Sequence:CCGGCCTCTAACACTCATCTTCAAACTCGAGTTTGAAGATGAGTGTTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004046.3-1190s1c1
Sequence:CCGGTCTGCTTACATTCCAACAAATCTCGAGATTTGTTGGAATGTAAGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043424    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004046.3-249s1c1
Sequence:CCGGCCTCTGTTGATCTTGAAGAAACTCGAGTTTCTTCAAGATCAACAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks