EMAIL THIS PAGE TO A FRIEND

ATP5B

ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide

83 Gene Product Result for
Synonyms: ATPMB ATPSB
UniProtKB ID: P06576, A8K4X0, Q14283
Gene ID:
Human(506) Summary: This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the beta subunit of the catalytic core. [provided by RefSeq, Jul 2008]
Mouse(11947) ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit
Rat(171374) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Zebrafish(554135) ATP synthase, H+ transporting mitochondrial F1 complex, beta subunit
cow(327675) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Horse(100059825) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
domestic cat(101087245) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
dog(403669) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
chicken(426673) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
sheep(101106318) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Domestic Rabbit(100353514) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
domestic guinea pig(100718614) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
naked mole-rat(101701683) ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV48185 Anti-ATP5B (AB1) antibody produced in rabbit IgG fraction of antiserum, lyophilized powder pig, rat, bovine, mouse, canine, human, horse, rabbit, rabbit
immunohistochemistry, western blot pricing
AV48186 Anti-ATP5B (AB2) antibody produced in rabbit IgG fraction of antiserum horse, human, zebrafish, mouse, rabbit, rat, guinea pig, bovine
western blot pricing
GW22827 Anti-ATP5B antibody produced in chicken affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
SAB1405500 Anti-ATP5B antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2108051 Anti-ATP5B antibody produced in rabbit IgG fraction of antiserum horse, yeast, bovine, mouse, canine, guinea pig, human, pig, rat, rabbit
immunohistochemistry, western blot pricing
HPA001520 Anti-ATP5B antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA001528 Anti-ATP5B antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, rat, human
immunofluorescence, immunohistochemistry, western blot pricing
A9728 Monoclonal Anti-ATP Synthase β antibody produced in mouse 1 mg/mL, clone 4.3E8.D10, purified immunoglobulin, buffered aqueous solution human, mouse, rat
immunofluorescence, immunoprecipitation, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0837 AQUA Peptide VVDLLAPYA[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001686 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001686 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001686 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016774 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016774 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016774 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001686 Rosetta Predictions human pricing
NM_134364 Rosetta Predictions rat pricing
NM_016774 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001686 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332344 predicted 997
2 SASI_Hs01_00210139 predicted 402
3 SASI_Hs01_00210142 predicted 645
4 SASI_Hs01_00210145 predicted 234
5 SASI_Hs02_00332345 predicted 233
6 SASI_Hs02_00332346 predicted 889
7 SASI_Hs02_00332347 predicted 649
8 SASI_Hs01_00210140 predicted 1317
9 SASI_Hs02_00332348 predicted 1122
10 SASI_Hs02_00332349 predicted 1604
11 SASI_Hs01_00210141 predicted 638
12 SASI_Hs01_00210143 predicted 838
13 SASI_Hs01_00210144 predicted 534
14 SASI_Hs01_00210146 predicted 516
15 SASI_Hs01_00210147 predicted 427
16 SASI_Hs01_00210148 predicted 841
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134364 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087782 predicted 555
2 SASI_Rn02_00267925 predicted 449
3 SASI_Rn01_00087787 predicted 1509
4 SASI_Rn01_00087788 predicted 446
5 SASI_Rn01_00087790 predicted 1038
6 SASI_Rn02_00267926 predicted 671
7 SASI_Rn01_00087783 predicted 915
8 SASI_Rn01_00087784 predicted 656
9 SASI_Rn01_00087785 predicted 547
10 SASI_Rn02_00267927 predicted 1183
11 SASI_Rn01_00087786 predicted 747
12 SASI_Rn01_00087789 predicted 1196
13 SASI_Rn01_00087791 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016774 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323540 predicted 372
2 SASI_Mm01_00131224 predicted 875
3 SASI_Mm01_00131225 predicted 905
4 SASI_Mm01_00131226 predicted 708
5 SASI_Mm01_00131227 predicted 744
6 SASI_Mm01_00131228 predicted 626
7 SASI_Mm01_00131229 predicted 1224
8 SASI_Mm01_00131230 predicted 1139
9 SASI_Mm02_00323541 predicted 654
10 SASI_Mm01_00131231 predicted 981
11 SASI_Mm01_00131222 predicted 566
12 SASI_Mm01_00131223 predicted 659
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001686
VALIDATED
ATP5B MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_001686.2-808s1c1
Sequence:CCGGGCTGGTATATGGTCAAATGAACTCGAGTTCATTTGACCATATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001686.2-1393s1c1
Sequence:CCGGGCGTTTCTTGTCTCAGCCATTCTCGAGAATGGCTGAGACAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001686.2-327s1c1
Sequence:CCGGGCACAGTAAGGACTATTGCTACTCGAGTAGCAATAGTCCTTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001686.2-964s1c1
Sequence:CCGGGTCTGCATTATTGGGCCGAATCTCGAGATTCGGCCCAATAATGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001686.2-154s1c1
Sequence:CCGGGCAAACATCTCCTTCGCCAAACTCGAGTTTGGCGAAGGAGATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001686.3-422s21c1
Sequence:CCGGGCACAGTAAGGACTATTGCTACTCGAGTAGCAATAGTCCTTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001686.3-903s21c1
Sequence:CCGGGCTGGTATATGGTCAAATGAACTCGAGTTCATTTGACCATATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001686.3-249s21c1
Sequence:CCGGGCAAACATCTCCTTCGCCAAACTCGAGTTTGGCGAAGGAGATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001686.3-1488s21c1
Sequence:CCGGGCGTTTCTTGTCTCAGCCATTCTCGAGAATGGCTGAGACAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001686.3-1059s21c1
Sequence:CCGGGTCTGCATTATTGGGCCGAATCTCGAGATTCGGCCCAATAATGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001686
VALIDATED
ATP5B MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_001686.2-808s1c1
Sequence:CCGGGCTGGTATATGGTCAAATGAACTCGAGTTCATTTGACCATATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001686.2-1393s1c1
Sequence:CCGGGCGTTTCTTGTCTCAGCCATTCTCGAGAATGGCTGAGACAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001686.2-327s1c1
Sequence:CCGGGCACAGTAAGGACTATTGCTACTCGAGTAGCAATAGTCCTTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001686.2-964s1c1
Sequence:CCGGGTCTGCATTATTGGGCCGAATCTCGAGATTCGGCCCAATAATGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001686.2-154s1c1
Sequence:CCGGGCAAACATCTCCTTCGCCAAACTCGAGTTTGGCGAAGGAGATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001686.3-422s21c1
Sequence:CCGGGCACAGTAAGGACTATTGCTACTCGAGTAGCAATAGTCCTTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001686.3-903s21c1
Sequence:CCGGGCTGGTATATGGTCAAATGAACTCGAGTTCATTTGACCATATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001686.3-249s21c1
Sequence:CCGGGCAAACATCTCCTTCGCCAAACTCGAGTTTGGCGAAGGAGATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001686.3-1488s21c1
Sequence:CCGGGCGTTTCTTGTCTCAGCCATTCTCGAGAATGGCTGAGACAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001686.3-1059s21c1
Sequence:CCGGGTCTGCATTATTGGGCCGAATCTCGAGATTCGGCCCAATAATGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001686
VALIDATED
ATP5B MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_001686.2-808s1c1
Sequence:CCGGGCTGGTATATGGTCAAATGAACTCGAGTTCATTTGACCATATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001686.2-1393s1c1
Sequence:CCGGGCGTTTCTTGTCTCAGCCATTCTCGAGAATGGCTGAGACAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001686.2-327s1c1
Sequence:CCGGGCACAGTAAGGACTATTGCTACTCGAGTAGCAATAGTCCTTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001686.2-964s1c1
Sequence:CCGGGTCTGCATTATTGGGCCGAATCTCGAGATTCGGCCCAATAATGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001686.2-154s1c1
Sequence:CCGGGCAAACATCTCCTTCGCCAAACTCGAGTTTGGCGAAGGAGATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001686.3-422s21c1
Sequence:CCGGGCACAGTAAGGACTATTGCTACTCGAGTAGCAATAGTCCTTACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001686.3-903s21c1
Sequence:CCGGGCTGGTATATGGTCAAATGAACTCGAGTTCATTTGACCATATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_001686.3-249s21c1
Sequence:CCGGGCAAACATCTCCTTCGCCAAACTCGAGTTTGGCGAAGGAGATGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001686.3-1488s21c1
Sequence:CCGGGCGTTTCTTGTCTCAGCCATTCTCGAGAATGGCTGAGACAAGAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_001686.3-1059s21c1
Sequence:CCGGGTCTGCATTATTGGGCCGAATCTCGAGATTCGGCCCAATAATGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016774
VALIDATED
ATP5B MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016774.2-1633s1c1
Sequence:CCGGCTGCAACTGATCTCTCCATATCTCGAGATATGGAGAGATCAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016774.2-337s1c1
Sequence:CCGGGCACGGTCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016774.2-1095s1c1
Sequence:CCGGGCTATCTATGTGCCTGCTGATCTCGAGATCAGCAGGCACATAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016774.2-1526s1c1
Sequence:CCGGCCCAGAACAAGCCTTCTACATCTCGAGATGTAGAAGGCTTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016774.3-337s21c1
Sequence:CCGGGCACGGTCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016774.3-674s21c1
Sequence:CCGGGCTAATCAACAATGTCGCCAACTCGAGTTGGCGACATTGTTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016774.3-1633s21c1
Sequence:CCGGCTGCAACTGATCTCTCCATATCTCGAGATATGGAGAGATCAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016774.2-674s1c2
Sequence:CCGGGCTAATCAACAATGTCGCCAACTCGAGTTGGCGACATTGTTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016774.3-1526s21c1
Sequence:CCGGCCCAGAACAAGCCTTCTACATCTCGAGATGTAGAAGGCTTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016774
VALIDATED
ATP5B MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016774.2-1633s1c1
Sequence:CCGGCTGCAACTGATCTCTCCATATCTCGAGATATGGAGAGATCAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016774.2-337s1c1
Sequence:CCGGGCACGGTCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016774.2-1095s1c1
Sequence:CCGGGCTATCTATGTGCCTGCTGATCTCGAGATCAGCAGGCACATAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016774.2-1526s1c1
Sequence:CCGGCCCAGAACAAGCCTTCTACATCTCGAGATGTAGAAGGCTTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016774.3-337s21c1
Sequence:CCGGGCACGGTCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016774.3-674s21c1
Sequence:CCGGGCTAATCAACAATGTCGCCAACTCGAGTTGGCGACATTGTTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016774.3-1633s21c1
Sequence:CCGGCTGCAACTGATCTCTCCATATCTCGAGATATGGAGAGATCAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016774.2-674s1c2
Sequence:CCGGGCTAATCAACAATGTCGCCAACTCGAGTTGGCGACATTGTTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016774.3-1526s21c1
Sequence:CCGGCCCAGAACAAGCCTTCTACATCTCGAGATGTAGAAGGCTTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016774
VALIDATED
ATP5B MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016774.2-1633s1c1
Sequence:CCGGCTGCAACTGATCTCTCCATATCTCGAGATATGGAGAGATCAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016774.2-337s1c1
Sequence:CCGGGCACGGTCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016774.2-1095s1c1
Sequence:CCGGGCTATCTATGTGCCTGCTGATCTCGAGATCAGCAGGCACATAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016774.2-1526s1c1
Sequence:CCGGCCCAGAACAAGCCTTCTACATCTCGAGATGTAGAAGGCTTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016774.3-337s21c1
Sequence:CCGGGCACGGTCAGAACTATTGCTACTCGAGTAGCAATAGTTCTGACCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016774.3-674s21c1
Sequence:CCGGGCTAATCAACAATGTCGCCAACTCGAGTTGGCGACATTGTTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309398    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016774.3-1633s21c1
Sequence:CCGGCTGCAACTGATCTCTCCATATCTCGAGATATGGAGAGATCAGTTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_016774.2-674s1c2
Sequence:CCGGGCTAATCAACAATGTCGCCAACTCGAGTTGGCGACATTGTTGATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016774.3-1526s21c1
Sequence:CCGGCCCAGAACAAGCCTTCTACATCTCGAGATGTAGAAGGCTTGTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks