EMAIL THIS PAGE TO A FRIEND

ATP5C1

ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1

74 Gene Product Result for
Synonyms: ATP5C ATP5CL1
UniProtKB ID: P36542, A8KA31, Q5VYP3, Q6I9V2, Q96AS8
Gene ID:
Human(509) Summary: This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the gamma subunit of the catalytic core. Alternatively spliced transcript variants encoding different isoforms have been identified. This gene also has a pseudogene on chromosome 14. [provided by RefSeq, Jul 2008]
Mouse(11949) ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Rat(116550) ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Zebrafish(336957) ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
chicken(419108) ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
domestic cat(101080547) ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
cow(327668) ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
dog(478009) ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
naked mole-rat(101696648) ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
domestic guinea pig(100712939) ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
sheep(101115299) ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005174 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001973 Rosetta Predictions human pricing
NM_005174 Rosetta Predictions human pricing
NM_053825 Rosetta Predictions rat pricing
NM_001112738 Rosetta Predictions mouse pricing
NM_020615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086870 predicted 283
2 SASI_Hs01_00086871 predicted 260
3 SASI_Hs01_00086872 predicted 343
4 SASI_Hs02_00304050 predicted 741
5 SASI_Hs01_00086874 predicted 261
6 SASI_Hs01_00086875 predicted 585
7 SASI_Hs01_00086876 predicted 374
8 SASI_Hs01_00086877 predicted 449
9 SASI_Hs01_00086878 predicted 452
10 SASI_Hs01_00086879 predicted 448
11 SASI_Hs01_00086873 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234558 predicted 289
2 SASI_Hs01_00234559 predicted 265
3 SASI_Hs01_00234560 predicted 351
4 SASI_Hs02_00339123 predicted 738
5 SASI_Hs01_00234562 predicted 258
6 SASI_Hs01_00234563 predicted 586
7 SASI_Hs01_00234564 predicted 377
8 SASI_Hs01_00234565 predicted 442
9 SASI_Hs01_00234566 predicted 456
10 SASI_Hs01_00234567 predicted 443
11 SASI_Hs01_00234561 predicted 500
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053825 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00104582 predicted 683
2 SASI_Rn01_00104583 predicted 342
3 SASI_Rn01_00104585 predicted 450
4 SASI_Rn01_00104586 predicted 407
5 SASI_Rn01_00104587 predicted 309
6 SASI_Rn01_00104588 predicted 534
7 SASI_Rn01_00104589 predicted 815
8 SASI_Rn01_00104590 predicted 672
9 SASI_Rn01_00104591 predicted 416
10 SASI_Rn02_00266660 predicted 428
11 SASI_Rn01_00104584 predicted 555
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001112738 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00307073 predicted 1419
2 SASI_Mm02_00307074 predicted 1108
3 SASI_Mm02_00307075 predicted 1243
4 SASI_Mm02_00307076 predicted 1155
5 SASI_Mm02_00307077 predicted 1252
6 SASI_Mm02_00307078 predicted 1250
7 SASI_Mm02_00307079 predicted 1073
8 SASI_Mm02_00307080 predicted 1207
9 SASI_Mm02_00307081 predicted 1498
10 SASI_Mm02_00307082 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325730 predicted 780
2 SASI_Mm02_00325731 predicted 474
3 SASI_Mm02_00325732 predicted 604
4 SASI_Mm02_00325733 predicted 521
5 SASI_Mm02_00325734 predicted 621
6 SASI_Mm02_00325735 predicted 612
7 SASI_Mm02_00325736 predicted 434
8 SASI_Mm02_00325737 predicted 575
9 SASI_Mm02_00325738 predicted 858
10 SASI_Mm02_00325739 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020615
VALIDATED
ATP5C1 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-332s21c1
Sequence:CCGGTCTGTATGAGAAGGCTGATATCTCGAGATATCAGCCTTCTCATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-309s21c1
Sequence:CCGGGTGTATGGGACAGGTTCTTTGCTCGAGCAAAGAACCTGTCCCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-295s21c1
Sequence:CCGGTGAAGCCTGCCCGAGTGTATGCTCGAGCATACACTCGGGCAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-352s21c1
Sequence:CCGGTTAAGGCACCTGAGGACAAGACTCGAGTCTTGTCCTCAGGTGCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-320s21c1
Sequence:CCGGAGGTTCTTTGGCTCTGTATGACTCGAGTCATACAGAGCCAAAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020615.2-933s1c1
Sequence:CCGGTCAAGTTGCATCCTCAGACAACTCGAGTTGTCTGAGGATGCAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020615.2-611s1c1
Sequence:CCGGCTCCTACAAGACAGAAGAGAACTCGAGTTCTCTTCTGTCTTGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020615.2-288s1c1
Sequence:CCGGGACAAGAAGAAGCACCTCATTCTCGAGAATGAGGTGCTTCTTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020615.2-254s1c1
Sequence:CCGGTCTGTATGAGAAGGCTGATATCTCGAGATATCAGCCTTCTCATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020615.2-357s1c1
Sequence:CCGGGTGGCTAAACAGATGAAGAATCTCGAGATTCTTCATCTGTTTAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020615
VALIDATED
ATP5C1 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-332s21c1
Sequence:CCGGTCTGTATGAGAAGGCTGATATCTCGAGATATCAGCCTTCTCATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-309s21c1
Sequence:CCGGGTGTATGGGACAGGTTCTTTGCTCGAGCAAAGAACCTGTCCCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-295s21c1
Sequence:CCGGTGAAGCCTGCCCGAGTGTATGCTCGAGCATACACTCGGGCAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-352s21c1
Sequence:CCGGTTAAGGCACCTGAGGACAAGACTCGAGTCTTGTCCTCAGGTGCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-320s21c1
Sequence:CCGGAGGTTCTTTGGCTCTGTATGACTCGAGTCATACAGAGCCAAAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020615.2-933s1c1
Sequence:CCGGTCAAGTTGCATCCTCAGACAACTCGAGTTGTCTGAGGATGCAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020615.2-611s1c1
Sequence:CCGGCTCCTACAAGACAGAAGAGAACTCGAGTTCTCTTCTGTCTTGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020615.2-288s1c1
Sequence:CCGGGACAAGAAGAAGCACCTCATTCTCGAGAATGAGGTGCTTCTTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020615.2-254s1c1
Sequence:CCGGTCTGTATGAGAAGGCTGATATCTCGAGATATCAGCCTTCTCATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020615.2-357s1c1
Sequence:CCGGGTGGCTAAACAGATGAAGAATCTCGAGATTCTTCATCTGTTTAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020615
VALIDATED
ATP5C1 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-332s21c1
Sequence:CCGGTCTGTATGAGAAGGCTGATATCTCGAGATATCAGCCTTCTCATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-309s21c1
Sequence:CCGGGTGTATGGGACAGGTTCTTTGCTCGAGCAAAGAACCTGTCCCATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306018    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-295s21c1
Sequence:CCGGTGAAGCCTGCCCGAGTGTATGCTCGAGCATACACTCGGGCAGGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-352s21c1
Sequence:CCGGTTAAGGCACCTGAGGACAAGACTCGAGTCTTGTCCTCAGGTGCCTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020615.4-320s21c1
Sequence:CCGGAGGTTCTTTGGCTCTGTATGACTCGAGTCATACAGAGCCAAAGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076218    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020615.2-933s1c1
Sequence:CCGGTCAAGTTGCATCCTCAGACAACTCGAGTTGTCTGAGGATGCAACTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020615.2-611s1c1
Sequence:CCGGCTCCTACAAGACAGAAGAGAACTCGAGTTCTCTTCTGTCTTGTAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020615.2-288s1c1
Sequence:CCGGGACAAGAAGAAGCACCTCATTCTCGAGAATGAGGTGCTTCTTCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020615.2-254s1c1
Sequence:CCGGTCTGTATGAGAAGGCTGATATCTCGAGATATCAGCCTTCTCATACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020615.2-357s1c1
Sequence:CCGGGTGGCTAAACAGATGAAGAATCTCGAGATTCTTCATCTGTTTAGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005174
VALIDATED
ATP5C1 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005174.2-494s21c1
Sequence:CCGGGCATACTTTATAGGACTCATTCTCGAGAATGAGTCCTATAAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005174.2-712s21c1
Sequence:CCGGGCTGACAGCATGAGTATCTATCTCGAGATAGATACTCATGCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005174.2-575s21c1
Sequence:CCGGCGTCAGTCATTGCCCTTGAATCTCGAGATTCAAGGGCAATGACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005174.2-293s21c1
Sequence:CCGGGATCTTTAGCTCTGTATGAAACTCGAGTTTCATACAGAGCTAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005174.2-868s21c1
Sequence:CCGGGCTTCTGAGATGATTGACAAACTCGAGTTTGTCAATCATCTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005174.1-665s1c1
Sequence:CCGGGCTGACAGCATGAGTATCTATCTCGAGATAGATACTCATGCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005174.1-447s1c1
Sequence:CCGGGCATACTTTATAGGACTCATTCTCGAGAATGAGTCCTATAAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005174.1-821s1c1
Sequence:CCGGGCTTCTGAGATGATTGACAAACTCGAGTTTGTCAATCATCTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005174.1-246s1c1
Sequence:CCGGGATCTTTAGCTCTGTATGAAACTCGAGTTTCATACAGAGCTAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005174
VALIDATED
ATP5C1 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005174.2-494s21c1
Sequence:CCGGGCATACTTTATAGGACTCATTCTCGAGAATGAGTCCTATAAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005174.2-712s21c1
Sequence:CCGGGCTGACAGCATGAGTATCTATCTCGAGATAGATACTCATGCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005174.2-575s21c1
Sequence:CCGGCGTCAGTCATTGCCCTTGAATCTCGAGATTCAAGGGCAATGACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005174.2-293s21c1
Sequence:CCGGGATCTTTAGCTCTGTATGAAACTCGAGTTTCATACAGAGCTAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005174.2-868s21c1
Sequence:CCGGGCTTCTGAGATGATTGACAAACTCGAGTTTGTCAATCATCTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005174.1-665s1c1
Sequence:CCGGGCTGACAGCATGAGTATCTATCTCGAGATAGATACTCATGCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005174.1-447s1c1
Sequence:CCGGGCATACTTTATAGGACTCATTCTCGAGAATGAGTCCTATAAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005174.1-821s1c1
Sequence:CCGGGCTTCTGAGATGATTGACAAACTCGAGTTTGTCAATCATCTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005174.1-246s1c1
Sequence:CCGGGATCTTTAGCTCTGTATGAAACTCGAGTTTCATACAGAGCTAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005174
VALIDATED
ATP5C1 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_005174.2-494s21c1
Sequence:CCGGGCATACTTTATAGGACTCATTCTCGAGAATGAGTCCTATAAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005174.2-712s21c1
Sequence:CCGGGCTGACAGCATGAGTATCTATCTCGAGATAGATACTCATGCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_005174.2-575s21c1
Sequence:CCGGCGTCAGTCATTGCCCTTGAATCTCGAGATTCAAGGGCAATGACTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005174.2-293s21c1
Sequence:CCGGGATCTTTAGCTCTGTATGAAACTCGAGTTTCATACAGAGCTAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005174.2-868s21c1
Sequence:CCGGGCTTCTGAGATGATTGACAAACTCGAGTTTGTCAATCATCTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043448    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005174.1-665s1c1
Sequence:CCGGGCTGACAGCATGAGTATCTATCTCGAGATAGATACTCATGCTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_005174.1-447s1c1
Sequence:CCGGGCATACTTTATAGGACTCATTCTCGAGAATGAGTCCTATAAAGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005174.1-821s1c1
Sequence:CCGGGCTTCTGAGATGATTGACAAACTCGAGTTTGTCAATCATCTCAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005174.1-246s1c1
Sequence:CCGGGATCTTTAGCTCTGTATGAAACTCGAGTTTCATACAGAGCTAAAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks