EMAIL THIS PAGE TO A FRIEND

ATP5D

ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit

64 Gene Product Result for
UniProtKB ID: P30049, D6W5Y3, Q6FG90
Gene ID:
Human(513) Summary: This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the delta subunit of the catalytic core. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
Mouse(66043) ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Rat(245965) ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Zebrafish(335709) ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
cow(338081) ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
domestic cat(101085528) ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
dog(476756) ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
chicken(771478) ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
naked mole-rat(101706462) ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
domestic guinea pig(100731138) ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
sheep(101117502) ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001687 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001687 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001687 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025313 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025313 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025313 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU042401 MISSION® esiRNA esiRNA targeting mouse Atp5d (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001975 Rosetta Predictions human pricing
NM_001687 Rosetta Predictions human pricing
NM_139106 Rosetta Predictions rat pricing
NM_025313 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001975 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149474 predicted 604
2 SASI_Hs02_00304056 predicted 419
3 SASI_Hs01_00149476 predicted 549
4 SASI_Hs01_00149477 predicted 230
5 SASI_Hs01_00149478 predicted 456
6 SASI_Hs01_00149479 predicted 453
7 SASI_Hs01_00149480 predicted 225
8 SASI_Hs01_00149481 predicted 427
9 SASI_Hs01_00149482 predicted 309
10 SASI_Hs01_00149483 predicted 239
11 SASI_Hs01_00149475 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001687 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124696 predicted 832
2 SASI_Hs01_00124697 predicted 796
3 SASI_Hs01_00124698 predicted 798
4 SASI_Hs01_00124699 predicted 924
5 SASI_Hs01_00124700 predicted 841
6 SASI_Hs01_00124701 predicted 910
7 SASI_Hs01_00124702 predicted 237
8 SASI_Hs01_00124703 predicted 240
9 SASI_Hs01_00124704 predicted 421
10 SASI_Hs01_00124705 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268482 predicted 339
2 SASI_Rn01_00116243 predicted 298
3 SASI_Rn02_00268483 predicted 273
4 SASI_Rn01_00116244 predicted 390
5 SASI_Rn01_00116245 predicted 316
6 SASI_Rn01_00116246 predicted 379
7 SASI_Rn01_00116248 predicted 499
8 SASI_Rn01_00116249 predicted 307
9 SASI_Rn01_00116250 predicted 220
10 SASI_Rn01_00116251 predicted 546
11 SASI_Rn01_00116247 predicted 567
12 SASI_Rn01_00116252 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025313 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327944 predicted 298
2 SASI_Mm01_00045194 predicted 250
3 SASI_Mm01_00045195 predicted 443
4 SASI_Mm02_00327945 predicted 400
5 SASI_Mm02_00327946 predicted 377
6 SASI_Mm02_00327947 predicted 704
7 SASI_Mm02_00327948 predicted 254
8 SASI_Mm01_00045198 predicted 347
9 SASI_Mm02_00327949 predicted 647
10 SASI_Mm01_00045199 predicted 478
11 SASI_Mm01_00045196 predicted 554
12 SASI_Mm01_00045197 predicted 458
13 SASI_Mm01_00045200 predicted 292
14 SASI_Mm01_00045201 predicted 305
15 SASI_Mm01_00045202 predicted 565
16 SASI_Mm01_00045203 predicted 611
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001687
VALIDATED
ATP5D MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-382s1c1
Sequence:CCGGCCTCCAAATACTTTGTGAGCACTCGAGTGCTCACAAAGTATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-401s1c1
Sequence:CCGGCAGCGGTTCCATCGCAGTGAACTCGAGTTCACTGCGATGGAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-549s1c1
Sequence:CCGGCGGGCAGAGATCCAGATCCGACTCGAGTCGGATCTGGATCTCTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-422s1c1
Sequence:CCGGCGCCGACTCTTCGGTGCAGTTCTCGAGAACTGCACCGAAGAGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-206s1c1
Sequence:CCGGCAACCAGATGTCCTTCACCTTCTCGAGAAGGTGAAGGACATCTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001687.4-382s21c1
Sequence:CCGGCCTCCAAATACTTTGTGAGCACTCGAGTGCTCACAAAGTATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001687.4-549s21c1
Sequence:CCGGCGGGCAGAGATCCAGATCCGACTCGAGTCGGATCTGGATCTCTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001687.4-401s21c1
Sequence:CCGGCAGCGGTTCCATCGCAGTGAACTCGAGTTCACTGCGATGGAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001687.4-422s21c1
Sequence:CCGGCGCCGACTCTTCGGTGCAGTTCTCGAGAACTGCACCGAAGAGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001687
VALIDATED
ATP5D MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-382s1c1
Sequence:CCGGCCTCCAAATACTTTGTGAGCACTCGAGTGCTCACAAAGTATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-401s1c1
Sequence:CCGGCAGCGGTTCCATCGCAGTGAACTCGAGTTCACTGCGATGGAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-549s1c1
Sequence:CCGGCGGGCAGAGATCCAGATCCGACTCGAGTCGGATCTGGATCTCTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-422s1c1
Sequence:CCGGCGCCGACTCTTCGGTGCAGTTCTCGAGAACTGCACCGAAGAGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-206s1c1
Sequence:CCGGCAACCAGATGTCCTTCACCTTCTCGAGAAGGTGAAGGACATCTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001687.4-382s21c1
Sequence:CCGGCCTCCAAATACTTTGTGAGCACTCGAGTGCTCACAAAGTATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001687.4-549s21c1
Sequence:CCGGCGGGCAGAGATCCAGATCCGACTCGAGTCGGATCTGGATCTCTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001687.4-401s21c1
Sequence:CCGGCAGCGGTTCCATCGCAGTGAACTCGAGTTCACTGCGATGGAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001687.4-422s21c1
Sequence:CCGGCGCCGACTCTTCGGTGCAGTTCTCGAGAACTGCACCGAAGAGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001687
VALIDATED
ATP5D MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-382s1c1
Sequence:CCGGCCTCCAAATACTTTGTGAGCACTCGAGTGCTCACAAAGTATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-401s1c1
Sequence:CCGGCAGCGGTTCCATCGCAGTGAACTCGAGTTCACTGCGATGGAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-549s1c1
Sequence:CCGGCGGGCAGAGATCCAGATCCGACTCGAGTCGGATCTGGATCTCTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-422s1c1
Sequence:CCGGCGCCGACTCTTCGGTGCAGTTCTCGAGAACTGCACCGAAGAGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_001687.3-206s1c1
Sequence:CCGGCAACCAGATGTCCTTCACCTTCTCGAGAAGGTGAAGGACATCTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001687.4-382s21c1
Sequence:CCGGCCTCCAAATACTTTGTGAGCACTCGAGTGCTCACAAAGTATTTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290951    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001687.4-549s21c1
Sequence:CCGGCGGGCAGAGATCCAGATCCGACTCGAGTCGGATCTGGATCTCTGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291021    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001687.4-401s21c1
Sequence:CCGGCAGCGGTTCCATCGCAGTGAACTCGAGTTCACTGCGATGGAACCGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290950    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001687.4-422s21c1
Sequence:CCGGCGCCGACTCTTCGGTGCAGTTCTCGAGAACTGCACCGAAGAGTCGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025313
VALIDATED
ATP5D MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025313.1-706s1c1
Sequence:CCGGGCTCCAGTTGCTGGGCTTAAACTCGAGTTTAAGCCCAGCAACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025313.1-432s1c1
Sequence:CCGGTCTGTGCAGTTACTAGCTGAACTCGAGTTCAGCTAGTAACTGCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025313.1-206s1c1
Sequence:CCGGCGGACAGATGTCCTTCACCTTCTCGAGAAGGTGAAGGACATCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025313.1-435s1c1
Sequence:CCGGGTGCAGTTACTAGCTGAAGAACTCGAGTTCTTCAGCTAGTAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025313.1-552s1c1
Sequence:CCGGGCTGAGATCCAGATCCGTATTCTCGAGAATACGGATCTGGATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025313
VALIDATED
ATP5D MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025313.1-706s1c1
Sequence:CCGGGCTCCAGTTGCTGGGCTTAAACTCGAGTTTAAGCCCAGCAACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025313.1-432s1c1
Sequence:CCGGTCTGTGCAGTTACTAGCTGAACTCGAGTTCAGCTAGTAACTGCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025313.1-206s1c1
Sequence:CCGGCGGACAGATGTCCTTCACCTTCTCGAGAAGGTGAAGGACATCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025313.1-435s1c1
Sequence:CCGGGTGCAGTTACTAGCTGAAGAACTCGAGTTCTTCAGCTAGTAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025313.1-552s1c1
Sequence:CCGGGCTGAGATCCAGATCCGTATTCTCGAGAATACGGATCTGGATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025313
VALIDATED
ATP5D MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial F1 complex, delta subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025313.1-706s1c1
Sequence:CCGGGCTCCAGTTGCTGGGCTTAAACTCGAGTTTAAGCCCAGCAACTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025313.1-432s1c1
Sequence:CCGGTCTGTGCAGTTACTAGCTGAACTCGAGTTCAGCTAGTAACTGCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076147    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025313.1-206s1c1
Sequence:CCGGCGGACAGATGTCCTTCACCTTCTCGAGAAGGTGAAGGACATCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025313.1-435s1c1
Sequence:CCGGGTGCAGTTACTAGCTGAAGAACTCGAGTTCTTCAGCTAGTAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025313.1-552s1c1
Sequence:CCGGGCTGAGATCCAGATCCGTATTCTCGAGAATACGGATCTGGATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks