EMAIL THIS PAGE TO A FRIEND

ATP5E

ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit

58 Gene Product Result for
Synonyms: ATPE MC5DN3
UniProtKB ID: P56381, B2RDD0, E1P5H6, Q53XU6
Gene ID:
Human(514) Summary: This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the epsilon subunit of the catalytic core. Two pseudogenes of this gene are located on chromosomes 4 and 13. Read-through transcripts that include exons from this gene are expressed from the upstream gene SLMO2.[provided by RefSeq, Mar 2011]
Mouse(67126) ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
Rat(245958) ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
domestic guinea pig(100733276) ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
naked mole-rat(101720946) ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
Zebrafish(798291) ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
chicken(768660) ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
cow(617230) ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025983 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025983 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025983 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006886 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001977 Rosetta Predictions human pricing
NM_006886 Rosetta Predictions human pricing
NM_139099 Rosetta Predictions rat pricing
NM_025983 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079954 predicted 327
2 SASI_Hs01_00079956 predicted 139
3 SASI_Hs01_00079957 predicted 313
4 SASI_Hs01_00079958 predicted 293
5 SASI_Hs01_00079959 predicted 185
6 SASI_Hs01_00079960 predicted 153
7 SASI_Hs01_00079961 predicted 219
8 SASI_Hs01_00079962 predicted 190
9 SASI_Hs02_00304057 predicted 264
10 SASI_Hs02_00304058 predicted 253
11 SASI_Hs01_00079955 predicted 397
12 SASI_Hs01_00079963 predicted 143
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221942 predicted 298
2 SASI_Hs01_00221944 predicted 112
3 SASI_Hs01_00221945 predicted 292
4 SASI_Hs01_00221946 predicted 271
5 SASI_Hs01_00221947 predicted 170
6 SASI_Hs01_00221948 predicted 125
7 SASI_Hs01_00221949 predicted 204
8 SASI_Hs01_00221950 predicted 168
9 SASI_Hs02_00342547 predicted 241
10 SASI_Hs02_00342548 predicted 233
11 SASI_Hs01_00221943 predicted 376
12 SASI_Hs01_00221951 predicted 117
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00043878 predicted 317
2 SASI_Rn01_00043879 predicted 299
3 SASI_Rn01_00043880 predicted 325
4 SASI_Rn02_00268472 predicted 324
5 SASI_Rn01_00043882 predicted 349
6 SASI_Rn01_00043883 predicted 91
7 SASI_Rn01_00043884 predicted 307
8 SASI_Rn01_00043885 predicted 338
9 SASI_Rn02_00268473 predicted 245
10 SASI_Rn01_00043886 predicted 91
11 SASI_Rn01_00043877 predicted 147
12 SASI_Rn01_00043881 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025983 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058033 predicted 362
2 SASI_Mm01_00058034 predicted 180
3 SASI_Mm01_00058035 predicted 121
4 SASI_Mm01_00058036 predicted 356
5 SASI_Mm01_00058037 predicted 243
6 SASI_Mm01_00058038 predicted 354
7 SASI_Mm01_00058039 predicted 269
8 SASI_Mm01_00058040 predicted 278
9 SASI_Mm01_00058041 predicted 212
10 SASI_Mm01_00058042 predicted 367
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025983
VALIDATED
ATP5E MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025983.3-186s21c1
Sequence:CCGGGAAGACCGAGTTCAAAGCGAACTCGAGTTCGCTTTGAACTCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025983.3-277s21c1
Sequence:CCGGCCTGAAGTGCTGAGTCTTGAACTCGAGTTCAAGACTCAGCACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025983.3-243s21c1
Sequence:CCGGGAAAGTCTCGAAGAAGGAGTACTCGAGTACTCCTTCTTCGAGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025983.3-195s21c1
Sequence:CCGGGTTCAAAGCGAACGCTGAGAACTCGAGTTCTCAGCGTTCGCTTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025983.3-170s21c1
Sequence:CCGGCAGTGAGGGATGCCCTGAAGACTCGAGTCTTCAGGGCATCCCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-179s1c2
Sequence:CCGGGAAGACCGAGTTCAAAGCGAACTCGAGTTCGCTTTGAACTCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-270s1c1
Sequence:CCGGCCTGAAGTGCTGAGTCTTGAACTCGAGTTCAAGACTCAGCACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-236s1c1
Sequence:CCGGGAAAGTCTCGAAGAAGGAGTACTCGAGTACTCCTTCTTCGAGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-188s1c1
Sequence:CCGGGTTCAAAGCGAACGCTGAGAACTCGAGTTCTCAGCGTTCGCTTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-163s1c1
Sequence:CCGGCAGTGAGGGATGCCCTGAAGACTCGAGTCTTCAGGGCATCCCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025983
VALIDATED
ATP5E MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025983.3-186s21c1
Sequence:CCGGGAAGACCGAGTTCAAAGCGAACTCGAGTTCGCTTTGAACTCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025983.3-277s21c1
Sequence:CCGGCCTGAAGTGCTGAGTCTTGAACTCGAGTTCAAGACTCAGCACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025983.3-243s21c1
Sequence:CCGGGAAAGTCTCGAAGAAGGAGTACTCGAGTACTCCTTCTTCGAGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025983.3-195s21c1
Sequence:CCGGGTTCAAAGCGAACGCTGAGAACTCGAGTTCTCAGCGTTCGCTTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025983.3-170s21c1
Sequence:CCGGCAGTGAGGGATGCCCTGAAGACTCGAGTCTTCAGGGCATCCCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-179s1c2
Sequence:CCGGGAAGACCGAGTTCAAAGCGAACTCGAGTTCGCTTTGAACTCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-270s1c1
Sequence:CCGGCCTGAAGTGCTGAGTCTTGAACTCGAGTTCAAGACTCAGCACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-236s1c1
Sequence:CCGGGAAAGTCTCGAAGAAGGAGTACTCGAGTACTCCTTCTTCGAGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-188s1c1
Sequence:CCGGGTTCAAAGCGAACGCTGAGAACTCGAGTTCTCAGCGTTCGCTTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-163s1c1
Sequence:CCGGCAGTGAGGGATGCCCTGAAGACTCGAGTCTTCAGGGCATCCCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025983
VALIDATED
ATP5E MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025983.3-186s21c1
Sequence:CCGGGAAGACCGAGTTCAAAGCGAACTCGAGTTCGCTTTGAACTCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025983.3-277s21c1
Sequence:CCGGCCTGAAGTGCTGAGTCTTGAACTCGAGTTCAAGACTCAGCACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025983.3-243s21c1
Sequence:CCGGGAAAGTCTCGAAGAAGGAGTACTCGAGTACTCCTTCTTCGAGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334638    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025983.3-195s21c1
Sequence:CCGGGTTCAAAGCGAACGCTGAGAACTCGAGTTCTCAGCGTTCGCTTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025983.3-170s21c1
Sequence:CCGGCAGTGAGGGATGCCCTGAAGACTCGAGTCTTCAGGGCATCCCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-179s1c2
Sequence:CCGGGAAGACCGAGTTCAAAGCGAACTCGAGTTCGCTTTGAACTCGGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076133    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-270s1c1
Sequence:CCGGCCTGAAGTGCTGAGTCTTGAACTCGAGTTCAAGACTCAGCACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-236s1c1
Sequence:CCGGGAAAGTCTCGAAGAAGGAGTACTCGAGTACTCCTTCTTCGAGACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-188s1c1
Sequence:CCGGGTTCAAAGCGAACGCTGAGAACTCGAGTTCTCAGCGTTCGCTTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025983.2-163s1c1
Sequence:CCGGCAGTGAGGGATGCCCTGAAGACTCGAGTCTTCAGGGCATCCCTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006886
VALIDATED
ATP5E MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006886.2-170s21c1
Sequence:CCGGGCACTGAAGACAGAATTCAAACTCGAGTTTGAATTCTGTCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006886.2-205s21c1
Sequence:CCGGGACTTCTGGCAGCAACGTAAACTCGAGTTTACGTTGCTGCCAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006886.2-157s21c1
Sequence:CCGGAGCAGTGAGAGATGCACTGAACTCGAGTTCAGTGCATCTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006886.2-127s21c1
Sequence:CCGGCTACATCCGATACTCCCAGATCTCGAGATCTGGGAGTATCGGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-170s1c1
Sequence:CCGGGCACTGAAGACAGAATTCAAACTCGAGTTTGAATTCTGTCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-175s1c1
Sequence:CCGGGAAGACAGAATTCAAAGCAAACTCGAGTTTGCTTTGAATTCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-157s1c1
Sequence:CCGGAGCAGTGAGAGATGCACTGAACTCGAGTTCAGTGCATCTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-205s1c1
Sequence:CCGGGACTTCTGGCAGCAACGTAAACTCGAGTTTACGTTGCTGCCAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-127s1c1
Sequence:CCGGCTACATCCGATACTCCCAGATCTCGAGATCTGGGAGTATCGGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006886
VALIDATED
ATP5E MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006886.2-170s21c1
Sequence:CCGGGCACTGAAGACAGAATTCAAACTCGAGTTTGAATTCTGTCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006886.2-205s21c1
Sequence:CCGGGACTTCTGGCAGCAACGTAAACTCGAGTTTACGTTGCTGCCAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006886.2-157s21c1
Sequence:CCGGAGCAGTGAGAGATGCACTGAACTCGAGTTCAGTGCATCTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006886.2-127s21c1
Sequence:CCGGCTACATCCGATACTCCCAGATCTCGAGATCTGGGAGTATCGGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-170s1c1
Sequence:CCGGGCACTGAAGACAGAATTCAAACTCGAGTTTGAATTCTGTCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-175s1c1
Sequence:CCGGGAAGACAGAATTCAAAGCAAACTCGAGTTTGCTTTGAATTCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-157s1c1
Sequence:CCGGAGCAGTGAGAGATGCACTGAACTCGAGTTCAGTGCATCTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-205s1c1
Sequence:CCGGGACTTCTGGCAGCAACGTAAACTCGAGTTTACGTTGCTGCCAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-127s1c1
Sequence:CCGGCTACATCCGATACTCCCAGATCTCGAGATCTGGGAGTATCGGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006886
VALIDATED
ATP5E MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial F1 complex, epsilon subunit
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006886.2-170s21c1
Sequence:CCGGGCACTGAAGACAGAATTCAAACTCGAGTTTGAATTCTGTCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006886.2-205s21c1
Sequence:CCGGGACTTCTGGCAGCAACGTAAACTCGAGTTTACGTTGCTGCCAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006886.2-157s21c1
Sequence:CCGGAGCAGTGAGAGATGCACTGAACTCGAGTTCAGTGCATCTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_006886.2-127s21c1
Sequence:CCGGCTACATCCGATACTCCCAGATCTCGAGATCTGGGAGTATCGGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-170s1c1
Sequence:CCGGGCACTGAAGACAGAATTCAAACTCGAGTTTGAATTCTGTCTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038217    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-175s1c1
Sequence:CCGGGAAGACAGAATTCAAAGCAAACTCGAGTTTGCTTTGAATTCTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-157s1c1
Sequence:CCGGAGCAGTGAGAGATGCACTGAACTCGAGTTCAGTGCATCTCTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-205s1c1
Sequence:CCGGGACTTCTGGCAGCAACGTAAACTCGAGTTTACGTTGCTGCCAGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006886.2-127s1c1
Sequence:CCGGCTACATCCGATACTCCCAGATCTCGAGATCTGGGAGTATCGGATGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks