EMAIL THIS PAGE TO A FRIEND

ATP5F1

ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1

100 Gene Product Result for
Synonyms: PIG47
UniProtKB ID: P24539, Q9BQ68, Q9BRU8
Gene ID:
Human(515) Summary: This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the b subunit of the proton channel. [provided by RefSeq, Jul 2008]
Mouse(11950) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1
Rat(171375) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
Zebrafish(449787) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit b, isoform 1
cow(282701) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
domestic cat(101097006) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
dog(479901) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
chicken(419866) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
naked mole-rat(101696522) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
domestic guinea pig(100713328) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
sheep(101114570) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009725 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009725 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009725 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001688 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001688 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001688 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001688 Rosetta Predictions human pricing
NM_134365 Rosetta Predictions rat pricing
NM_009725 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001688 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172849 predicted 1142
2 SASI_Hs01_00172850 predicted 604
3 SASI_Hs01_00172847 predicted 873
4 SASI_Hs01_00172851 predicted 1183
5 SASI_Hs01_00172852 predicted 724
6 SASI_Hs01_00172853 predicted 1177
7 SASI_Hs01_00172854 predicted 1198
8 SASI_Hs01_00172855 predicted 1191
9 SASI_Hs02_00332350 predicted 576
10 SASI_Hs02_00332351 predicted 1245
11 SASI_Hs01_00172846 predicted 740
12 SASI_Hs01_00172848 predicted 1037
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134365 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070946 predicted 307
2 SASI_Rn01_00070947 predicted 223
3 SASI_Rn02_00267928 predicted 728
4 SASI_Rn01_00070948 predicted 296
5 SASI_Rn01_00070949 predicted 560
6 SASI_Rn01_00070951 predicted 548
7 SASI_Rn01_00070952 predicted 593
8 SASI_Rn01_00070953 predicted 866
9 SASI_Rn01_00070954 predicted 467
10 SASI_Rn01_00070955 predicted 877
11 SASI_Rn01_00070950 predicted 906
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009725 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316882 predicted 876
2 SASI_Mm01_00130840 predicted 975
3 SASI_Mm01_00130841 predicted 724
4 SASI_Mm01_00130843 predicted 873
5 SASI_Mm01_00130844 predicted 853
6 SASI_Mm02_00316883 predicted 1175
7 SASI_Mm01_00130845 predicted 1093
8 SASI_Mm01_00130847 predicted 797
9 SASI_Mm01_00130848 predicted 1051
10 SASI_Mm01_00130849 predicted 1187
11 SASI_Mm01_00130842 predicted 1032
12 SASI_Mm01_00130846 predicted 1065
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009725
ATP5F1 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000054443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-247s1c1
Sequence:CCGGCCTGAGGACTTAGCTTGTATTCTCGAGAATACAAGCTAAGTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-207s1c1
Sequence:CCGGTCTTCCTGAATATGGAGGAAACTCGAGTTTCCTCCATATTCAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-150s1c1
Sequence:CCGGATTACAGGCAACAAGGGCCTTCTCGAGAAGGCCCTTGTTGCCTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-166s1c1
Sequence:CCGGGCCTTTCACACAGGACAGCCTCTCGAGAGGCTGTCCTGTGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000054446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-237s1c1
Sequence:CCGGTGGGCTGATTCCTGAGGACTTCTCGAGAAGTCCTCAGGAATCAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009725
ATP5F1 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000054443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-247s1c1
Sequence:CCGGCCTGAGGACTTAGCTTGTATTCTCGAGAATACAAGCTAAGTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-207s1c1
Sequence:CCGGTCTTCCTGAATATGGAGGAAACTCGAGTTTCCTCCATATTCAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-150s1c1
Sequence:CCGGATTACAGGCAACAAGGGCCTTCTCGAGAAGGCCCTTGTTGCCTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-166s1c1
Sequence:CCGGGCCTTTCACACAGGACAGCCTCTCGAGAGGCTGTCCTGTGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000054446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-237s1c1
Sequence:CCGGTGGGCTGATTCCTGAGGACTTCTCGAGAAGTCCTCAGGAATCAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009725
ATP5F1 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000054443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-247s1c1
Sequence:CCGGCCTGAGGACTTAGCTTGTATTCTCGAGAATACAAGCTAAGTCCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-207s1c1
Sequence:CCGGTCTTCCTGAATATGGAGGAAACTCGAGTTTCCTCCATATTCAGGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-150s1c1
Sequence:CCGGATTACAGGCAACAAGGGCCTTCTCGAGAAGGCCCTTGTTGCCTGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-166s1c1
Sequence:CCGGGCCTTTCACACAGGACAGCCTCTCGAGAGGCTGTCCTGTGTGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000054446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009725.1-237s1c1
Sequence:CCGGTGGGCTGATTCCTGAGGACTTCTCGAGAAGTCCTCAGGAATCAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001688
VALIDATED
ATP5F1 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-467s1c1
Sequence:CCGGGCTGATAAACTCAATGAGCAACTCGAGTTGCTCATTGAGTTTATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-235s1c1
Sequence:CCGGTCTTCCTGAATACGGAGGAAACTCGAGTTTCCTCCGTATTCAGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-644s1c1
Sequence:CCGGCGGGAACGACTGTATAGAGTACTCGAGTACTCTATACAGTCGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-706s1c1
Sequence:CCGGGCAGAACATGATGCGTCGAAACTCGAGTTTCGACGCATCATGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-352s1c1
Sequence:CCGGGTACGCTTTATCCAAAGAAATCTCGAGATTTCTTTGGATAAAGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001688.4-666s21c1
Sequence:CCGGGGCTTATCTTGTACGCTTTATCTCGAGATAAAGCGTACAAGATAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001688.4-1279s21c1
Sequence:CCGGGTCTACTGAAGTTATAGTTTACTCGAGTAAACTATAACTTCAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001688.4-856s21c1
Sequence:GTACCGGCATCCAGAATGCAATTGATACCTCGAGGTATCAATTGCATTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001688.4-1005s21c1
Sequence:CCGGATCGCCTGGACTATCATATATCTCGAGATATATGATAGTCCAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001688.4-727s21c1
Sequence:CCGGCCTATCAGTACTAGGTGTAATCTCGAGATTACACCTAGTACTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001688
VALIDATED
ATP5F1 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-467s1c1
Sequence:CCGGGCTGATAAACTCAATGAGCAACTCGAGTTGCTCATTGAGTTTATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-235s1c1
Sequence:CCGGTCTTCCTGAATACGGAGGAAACTCGAGTTTCCTCCGTATTCAGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-644s1c1
Sequence:CCGGCGGGAACGACTGTATAGAGTACTCGAGTACTCTATACAGTCGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-706s1c1
Sequence:CCGGGCAGAACATGATGCGTCGAAACTCGAGTTTCGACGCATCATGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-352s1c1
Sequence:CCGGGTACGCTTTATCCAAAGAAATCTCGAGATTTCTTTGGATAAAGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001688.4-666s21c1
Sequence:CCGGGGCTTATCTTGTACGCTTTATCTCGAGATAAAGCGTACAAGATAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001688.4-1279s21c1
Sequence:CCGGGTCTACTGAAGTTATAGTTTACTCGAGTAAACTATAACTTCAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001688.4-856s21c1
Sequence:GTACCGGCATCCAGAATGCAATTGATACCTCGAGGTATCAATTGCATTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001688.4-1005s21c1
Sequence:CCGGATCGCCTGGACTATCATATATCTCGAGATATATGATAGTCCAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001688.4-727s21c1
Sequence:CCGGCCTATCAGTACTAGGTGTAATCTCGAGATTACACCTAGTACTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001688
VALIDATED
ATP5F1 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-467s1c1
Sequence:CCGGGCTGATAAACTCAATGAGCAACTCGAGTTGCTCATTGAGTTTATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-235s1c1
Sequence:CCGGTCTTCCTGAATACGGAGGAAACTCGAGTTTCCTCCGTATTCAGGAAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029368    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-644s1c1
Sequence:CCGGCGGGAACGACTGTATAGAGTACTCGAGTACTCTATACAGTCGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-706s1c1
Sequence:CCGGGCAGAACATGATGCGTCGAAACTCGAGTTTCGACGCATCATGTTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001688.2-352s1c1
Sequence:CCGGGTACGCTTTATCCAAAGAAATCTCGAGATTTCTTTGGATAAAGCGTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257141    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001688.4-666s21c1
Sequence:CCGGGGCTTATCTTGTACGCTTTATCTCGAGATAAAGCGTACAAGATAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230284    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001688.4-1279s21c1
Sequence:CCGGGTCTACTGAAGTTATAGTTTACTCGAGTAAACTATAACTTCAGTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_001688.4-856s21c1
Sequence:GTACCGGCATCCAGAATGCAATTGATACCTCGAGGTATCAATTGCATTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001688.4-1005s21c1
Sequence:CCGGATCGCCTGGACTATCATATATCTCGAGATATATGATAGTCCAGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001688.4-727s21c1
Sequence:CCGGCCTATCAGTACTAGGTGTAATCTCGAGATTACACCTAGTACTGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks