EMAIL THIS PAGE TO A FRIEND

ATP5G1

ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)

58 Gene Product Result for
Synonyms: ATP5A ATP5G
UniProtKB ID: P05496
Gene ID:
Human(516) Summary: This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene is one of three genes that encode subunit c of the proton channel. Each of the three genes have distinct mitochondrial import sequences but encode the identical mature protein. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Mouse(11951) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c1 (subunit 9)
Rat(29754) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
Zebrafish(406301) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
chicken(419992) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
cow(338053) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
dog(491061) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
sheep(443410) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005175 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005175 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005175 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002027 Rosetta Predictions human pricing
NM_005175 Rosetta Predictions human pricing
NM_017311 Rosetta Predictions rat pricing
NM_007506 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002027 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064211 predicted 328
2 SASI_Hs01_00064212 predicted 322
3 SASI_Hs01_00064213 predicted 310
4 SASI_Hs01_00064214 predicted 251
5 SASI_Hs01_00064220 predicted 488
6 SASI_Hs01_00064215 predicted 91
7 SASI_Hs02_00304091 predicted 126
8 SASI_Hs01_00064216 predicted 529
9 SASI_Hs01_00064217 predicted 139
10 SASI_Hs01_00064218 predicted 389
11 SASI_Hs01_00064219 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005175 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093278 predicted 393
2 SASI_Hs01_00093279 predicted 394
3 SASI_Hs01_00093280 predicted 379
4 SASI_Hs01_00093281 predicted 329
5 SASI_Hs01_00093287 predicted 556
6 SASI_Hs01_00093282 predicted 165
7 SASI_Hs02_00339124 predicted 203
8 SASI_Hs01_00093283 predicted 603
9 SASI_Hs01_00093284 predicted 206
10 SASI_Hs01_00093285 predicted 455
11 SASI_Hs01_00093286 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039653 predicted 320
2 SASI_Rn01_00039654 predicted 321
3 SASI_Rn01_00039655 predicted 59
4 SASI_Rn01_00039656 predicted 359
5 SASI_Rn01_00039658 predicted 373
6 SASI_Rn01_00039657 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00311789 predicted 269
2 SASI_Mm02_00311790 predicted 702
3 SASI_Mm02_00311791 predicted 608
4 SASI_Mm02_00311792 predicted 611
5 SASI_Mm02_00311793 predicted 672
6 SASI_Mm02_00311794 predicted 825
7 SASI_Mm02_00311795 predicted 670
8 SASI_Mm02_00311796 predicted 895
9 SASI_Mm02_00311797 predicted 42
10 SASI_Mm02_00311798 predicted 278
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007506
VALIDATED
ATP5G1 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007506.5-371s21c1
Sequence:CCGGCCATGGGACTCTTCTGTTTGACTCGAGTCAAACAGAAGAGTCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007506.5-169s21c1
Sequence:CCGGGAATTCCAGACCAGTGTCATTCTCGAGAATGACACTGGTCTGGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007506.5-180s21c1
Sequence:CCGGCAGTGTCATTTCCCGGGACATCTCGAGATGTCCCGGGAAATGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007506.5-287s21c1
Sequence:CCGGGCTTGATTATTGGCTATGCCACTCGAGTGGCATAGCCAATAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007506.2-331s1c1
Sequence:CCGGGCTTGATTATTGGCTATGCCACTCGAGTGGCATAGCCAATAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007506.2-213s1c1
Sequence:CCGGGAATTCCAGACCAGTGTCATTCTCGAGAATGACACTGGTCTGGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007506.2-415s1c1
Sequence:CCGGCCATGGGACTCTTCTGTTTGACTCGAGTCAAACAGAAGAGTCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007506.2-224s1c1
Sequence:CCGGCAGTGTCATTTCCCGGGACATCTCGAGATGTCCCGGGAAATGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007506.2-88s1c1
Sequence:CCGGCAGCTCTGATTCGCTCCTGTACTCGAGTACAGGAGCGAATCAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007506
VALIDATED
ATP5G1 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007506.5-371s21c1
Sequence:CCGGCCATGGGACTCTTCTGTTTGACTCGAGTCAAACAGAAGAGTCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007506.5-169s21c1
Sequence:CCGGGAATTCCAGACCAGTGTCATTCTCGAGAATGACACTGGTCTGGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007506.5-180s21c1
Sequence:CCGGCAGTGTCATTTCCCGGGACATCTCGAGATGTCCCGGGAAATGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007506.5-287s21c1
Sequence:CCGGGCTTGATTATTGGCTATGCCACTCGAGTGGCATAGCCAATAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007506.2-331s1c1
Sequence:CCGGGCTTGATTATTGGCTATGCCACTCGAGTGGCATAGCCAATAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007506.2-213s1c1
Sequence:CCGGGAATTCCAGACCAGTGTCATTCTCGAGAATGACACTGGTCTGGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007506.2-415s1c1
Sequence:CCGGCCATGGGACTCTTCTGTTTGACTCGAGTCAAACAGAAGAGTCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007506.2-224s1c1
Sequence:CCGGCAGTGTCATTTCCCGGGACATCTCGAGATGTCCCGGGAAATGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007506.2-88s1c1
Sequence:CCGGCAGCTCTGATTCGCTCCTGTACTCGAGTACAGGAGCGAATCAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007506
VALIDATED
ATP5G1 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318171    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007506.5-371s21c1
Sequence:CCGGCCATGGGACTCTTCTGTTTGACTCGAGTCAAACAGAAGAGTCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007506.5-169s21c1
Sequence:CCGGGAATTCCAGACCAGTGTCATTCTCGAGAATGACACTGGTCTGGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007506.5-180s21c1
Sequence:CCGGCAGTGTCATTTCCCGGGACATCTCGAGATGTCCCGGGAAATGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007506.5-287s21c1
Sequence:CCGGGCTTGATTATTGGCTATGCCACTCGAGTGGCATAGCCAATAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007506.2-331s1c1
Sequence:CCGGGCTTGATTATTGGCTATGCCACTCGAGTGGCATAGCCAATAATCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007506.2-213s1c1
Sequence:CCGGGAATTCCAGACCAGTGTCATTCTCGAGAATGACACTGGTCTGGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007506.2-415s1c1
Sequence:CCGGCCATGGGACTCTTCTGTTTGACTCGAGTCAAACAGAAGAGTCCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075777    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007506.2-224s1c1
Sequence:CCGGCAGTGTCATTTCCCGGGACATCTCGAGATGTCCCGGGAAATGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007506.2-88s1c1
Sequence:CCGGCAGCTCTGATTCGCTCCTGTACTCGAGTACAGGAGCGAATCAGAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005175
VALIDATED
ATP5G1 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005175.2-218s21c1
Sequence:CCGGCTTCTTGAATAGCCCAGTGAACTCGAGTTCACTGGGCTATTCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005175.2-235s21c1
Sequence:CCGGTGAATTCATCTAAACAGCCTTCTCGAGAAGGCTGTTTAGATGAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005175.2-288s21c1
Sequence:CCGGCGGGAGTTCCAGACCAGTGTTCTCGAGAACACTGGTCTGGAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005175.2-434s21c1
Sequence:CCGGCCCGTCTCTCAAGCAGCAGCTCTCGAGAGCTGCTGCTTGAGAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005175.1-203s1c1
Sequence:CCGGCTTCTTGAATAGCCCAGTGAACTCGAGTTCACTGGGCTATTCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005175.1-273s1c1
Sequence:CCGGCGGGAGTTCCAGACCAGTGTTCTCGAGAACACTGGTCTGGAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005175.1-220s1c1
Sequence:CCGGTGAATTCATCTAAACAGCCTTCTCGAGAAGGCTGTTTAGATGAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_005175.1-419s1c1
Sequence:CCGGCCCGTCTCTCAAGCAGCAGCTCTCGAGAGCTGCTGCTTGAGAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005175.1-383s1c1
Sequence:CCGGCGTGTTTGGCAGCTTGATCATCTCGAGATGATCAAGCTGCCAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005175
VALIDATED
ATP5G1 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005175.2-218s21c1
Sequence:CCGGCTTCTTGAATAGCCCAGTGAACTCGAGTTCACTGGGCTATTCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005175.2-235s21c1
Sequence:CCGGTGAATTCATCTAAACAGCCTTCTCGAGAAGGCTGTTTAGATGAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005175.2-288s21c1
Sequence:CCGGCGGGAGTTCCAGACCAGTGTTCTCGAGAACACTGGTCTGGAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005175.2-434s21c1
Sequence:CCGGCCCGTCTCTCAAGCAGCAGCTCTCGAGAGCTGCTGCTTGAGAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005175.1-203s1c1
Sequence:CCGGCTTCTTGAATAGCCCAGTGAACTCGAGTTCACTGGGCTATTCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005175.1-273s1c1
Sequence:CCGGCGGGAGTTCCAGACCAGTGTTCTCGAGAACACTGGTCTGGAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005175.1-220s1c1
Sequence:CCGGTGAATTCATCTAAACAGCCTTCTCGAGAAGGCTGTTTAGATGAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_005175.1-419s1c1
Sequence:CCGGCCCGTCTCTCAAGCAGCAGCTCTCGAGAGCTGCTGCTTGAGAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005175.1-383s1c1
Sequence:CCGGCGTGTTTGGCAGCTTGATCATCTCGAGATGATCAAGCTGCCAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005175
VALIDATED
ATP5G1 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C1 (subunit 9)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005175.2-218s21c1
Sequence:CCGGCTTCTTGAATAGCCCAGTGAACTCGAGTTCACTGGGCTATTCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005175.2-235s21c1
Sequence:CCGGTGAATTCATCTAAACAGCCTTCTCGAGAAGGCTGTTTAGATGAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_005175.2-288s21c1
Sequence:CCGGCGGGAGTTCCAGACCAGTGTTCTCGAGAACACTGGTCTGGAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005175.2-434s21c1
Sequence:CCGGCCCGTCTCTCAAGCAGCAGCTCTCGAGAGCTGCTGCTTGAGAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005175.1-203s1c1
Sequence:CCGGCTTCTTGAATAGCCCAGTGAACTCGAGTTCACTGGGCTATTCAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_005175.1-273s1c1
Sequence:CCGGCGGGAGTTCCAGACCAGTGTTCTCGAGAACACTGGTCTGGAACTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_005175.1-220s1c1
Sequence:CCGGTGAATTCATCTAAACAGCCTTCTCGAGAAGGCTGTTTAGATGAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_005175.1-419s1c1
Sequence:CCGGCCCGTCTCTCAAGCAGCAGCTCTCGAGAGCTGCTGCTTGAGAGACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005175.1-383s1c1
Sequence:CCGGCGTGTTTGGCAGCTTGATCATCTCGAGATGATCAAGCTGCCAAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks