EMAIL THIS PAGE TO A FRIEND

ATP5G2

ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)

68 Gene Product Result for
Synonyms: ATP5A
UniProtKB ID: Q06055, B3KQQ6
Gene ID:
Human(517) Summary: This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). There are three separate genes which encode subunit c of the proton channel and they specify precursors with different import sequences but identical mature proteins. The protein encoded by this gene is one of three precursors of subunit c. Alternatively spliced transcript variants encoding different isoforms have been identified. This gene has multiple pseudogenes. [provided by RefSeq, Jun 2010]
Mouse(67942) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 (subunit 9)
Rat(171082) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)
cow(337887) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C2 (subunit 9)
dog(477595) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)
sheep(443542) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026468 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026468 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026468 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005176 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005176 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005176 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002031 Rosetta Predictions human pricing
NM_005176 Rosetta Predictions human pricing
NM_133556 Rosetta Predictions rat pricing
NM_026468 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002031 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00041607 predicted 768
2 SASI_Hs01_00041608 predicted 852
3 SASI_Hs01_00041609 predicted 865
4 SASI_Hs01_00041610 predicted 769
5 SASI_Hs01_00041611 predicted 748
6 SASI_Hs01_00041612 predicted 754
7 SASI_Hs01_00041613 predicted 761
8 SASI_Hs01_00041614 predicted 794
9 SASI_Hs01_00041615 predicted 891
10 SASI_Hs01_00041616 predicted 843
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005176 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172976 predicted 490
2 SASI_Hs01_00172977 predicted 576
3 SASI_Hs01_00172978 predicted 584
4 SASI_Hs01_00172979 predicted 483
5 SASI_Hs01_00172980 predicted 472
6 SASI_Hs01_00172981 predicted 472
7 SASI_Hs01_00172982 predicted 485
8 SASI_Hs01_00172983 predicted 512
9 SASI_Hs01_00172984 predicted 607
10 SASI_Hs01_00172985 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133556 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036256 predicted 232
2 SASI_Rn01_00036257 predicted 292
3 SASI_Rn01_00036258 predicted 378
4 SASI_Rn01_00036261 predicted 229
5 SASI_Rn02_00267746 predicted 202
6 SASI_Rn01_00036262 predicted 294
7 SASI_Rn01_00036263 predicted 226
8 SASI_Rn01_00036264 predicted 296
9 SASI_Rn02_00267747 predicted 235
10 SASI_Rn02_00267748 predicted 389
11 SASI_Rn01_00036255 predicted 198
12 SASI_Rn01_00036259 predicted 283
13 SASI_Rn01_00036260 predicted 349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026468 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025390 predicted 401
2 SASI_Mm01_00025391 predicted 253
3 SASI_Mm01_00025392 predicted 232
4 SASI_Mm01_00025393 predicted 212
5 SASI_Mm01_00025394 predicted 357
6 SASI_Mm01_00025395 predicted 201
7 SASI_Mm01_00025396 predicted 258
8 SASI_Mm01_00025397 predicted 257
9 SASI_Mm02_00330327 predicted 200
10 SASI_Mm01_00025398 predicted 204
11 SASI_Mm01_00025399 predicted 215
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026468
ATP5G2 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-217s1c1
Sequence:CCGGGCGGCCTCTGACTTCACTTATCTCGAGATAAGTGAAGTCAGAGGCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-407s1c1
Sequence:CCGGCAACTCTTCTCCTACGCGATTCTCGAGAATCGCGTAGGAGAAGAGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-181s1c1
Sequence:CCGGGCCAACAGATGAGAGCCTCAGCTCGAGCTGAGGCTCTCATCTGTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-93s1c1
Sequence:CCGGGCTCCCTGATCAGGAGCACCTCTCGAGAGGTGCTCCTGATCAGGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-249s1c1
Sequence:CCGGGTTTCCAAACCAGCGCCATTTCTCGAGAAATGGCGCTGGTTTGGAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026468.2-461s21c1
Sequence:CCGGTTTGCCTAATGGTGGCCTTTCCTCGAGGAAAGGCCACCATTAGGCAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026468.2-281s21c1
Sequence:CCGGACACAGCTGCCAAGTTCATTGCTCGAGCAATGAACTTGGCAGCTGTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026468.2-483s21c1
Sequence:CCGGCATCCTCTTCGCCATGTGAAGCTCGAGCTTCACATGGCGAAGAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026468.2-147s21c1
Sequence:CCGGGCTGTCTGCAGTGGAGTTGAACTCGAGTTCAACTCCACTGCAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026468
ATP5G2 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-217s1c1
Sequence:CCGGGCGGCCTCTGACTTCACTTATCTCGAGATAAGTGAAGTCAGAGGCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-407s1c1
Sequence:CCGGCAACTCTTCTCCTACGCGATTCTCGAGAATCGCGTAGGAGAAGAGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-181s1c1
Sequence:CCGGGCCAACAGATGAGAGCCTCAGCTCGAGCTGAGGCTCTCATCTGTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-93s1c1
Sequence:CCGGGCTCCCTGATCAGGAGCACCTCTCGAGAGGTGCTCCTGATCAGGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-249s1c1
Sequence:CCGGGTTTCCAAACCAGCGCCATTTCTCGAGAAATGGCGCTGGTTTGGAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026468.2-461s21c1
Sequence:CCGGTTTGCCTAATGGTGGCCTTTCCTCGAGGAAAGGCCACCATTAGGCAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026468.2-281s21c1
Sequence:CCGGACACAGCTGCCAAGTTCATTGCTCGAGCAATGAACTTGGCAGCTGTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026468.2-483s21c1
Sequence:CCGGCATCCTCTTCGCCATGTGAAGCTCGAGCTTCACATGGCGAAGAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026468.2-147s21c1
Sequence:CCGGGCTGTCTGCAGTGGAGTTGAACTCGAGTTCAACTCCACTGCAGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026468
ATP5G2 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-217s1c1
Sequence:CCGGGCGGCCTCTGACTTCACTTATCTCGAGATAAGTGAAGTCAGAGGCCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-407s1c1
Sequence:CCGGCAACTCTTCTCCTACGCGATTCTCGAGAATCGCGTAGGAGAAGAGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-181s1c1
Sequence:CCGGGCCAACAGATGAGAGCCTCAGCTCGAGCTGAGGCTCTCATCTGTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-93s1c1
Sequence:CCGGGCTCCCTGATCAGGAGCACCTCTCGAGAGGTGCTCCTGATCAGGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026468.1-249s1c1
Sequence:CCGGGTTTCCAAACCAGCGCCATTTCTCGAGAAATGGCGCTGGTTTGGAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026468.2-461s21c1
Sequence:CCGGTTTGCCTAATGGTGGCCTTTCCTCGAGGAAAGGCCACCATTAGGCAAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026468.2-281s21c1
Sequence:CCGGACACAGCTGCCAAGTTCATTGCTCGAGCAATGAACTTGGCAGCTGTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026468.2-483s21c1
Sequence:CCGGCATCCTCTTCGCCATGTGAAGCTCGAGCTTCACATGGCGAAGAGGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026468.2-147s21c1
Sequence:CCGGGCTGTCTGCAGTGGAGTTGAACTCGAGTTCAACTCCACTGCAGACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005176
VALIDATED
ATP5G2 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-205s1c1
Sequence:CCGGCCCTTACCTCACTTGTCTCTACTCGAGTAGAGACAAGTGAGGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-369s1c1
Sequence:CCGGAGGAACCCTTCTCTGAAGCAACTCGAGTTGCTTCAGAGAAGGGTTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-232s1c1
Sequence:CCGGGCTTCCAAACCAGCGCCATTTCTCGAGAAATGGCGCTGGTTTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-456s1c1
Sequence:CCGGGTAGCCTTTCTCATCCTCTTTCTCGAGAAAGAGGATGAGAAAGGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-153s1c1
Sequence:CCGGCGACCGGAGATACTGACAGATCTCGAGATCTGTCAGTATCTCCGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005176.5-477s21c1
Sequence:CCGGGCTTCCAAACCAGCGCCATTTCTCGAGAAATGGCGCTGGTTTGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005176.5-450s21c1
Sequence:CCGGCCCTTACCTCACTTGTCTCTACTCGAGTAGAGACAAGTGAGGTAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005176.5-398s21c1
Sequence:CCGGCGACCGGAGATACTGACAGATCTCGAGATCTGTCAGTATCTCCGGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005176.5-211s21c1
Sequence:CCGGTGAGCCTTCCTTTCGCTCTTCCTCGAGGAAGAGCGAAAGGAAGGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005176.5-701s21c1
Sequence:CCGGGTAGCCTTTCTCATCCTCTTTCTCGAGAAAGAGGATGAGAAAGGCTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005176.5-307s21c1
Sequence:CCGGGTTCGCCTGCTCCAAGTTTGTCTCGAGACAAACTTGGAGCAGGCGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005176
VALIDATED
ATP5G2 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-205s1c1
Sequence:CCGGCCCTTACCTCACTTGTCTCTACTCGAGTAGAGACAAGTGAGGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-369s1c1
Sequence:CCGGAGGAACCCTTCTCTGAAGCAACTCGAGTTGCTTCAGAGAAGGGTTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-232s1c1
Sequence:CCGGGCTTCCAAACCAGCGCCATTTCTCGAGAAATGGCGCTGGTTTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-456s1c1
Sequence:CCGGGTAGCCTTTCTCATCCTCTTTCTCGAGAAAGAGGATGAGAAAGGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000043490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-153s1c1
Sequence:CCGGCGACCGGAGATACTGACAGATCTCGAGATCTGTCAGTATCTCCGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005176.5-477s21c1
Sequence:CCGGGCTTCCAAACCAGCGCCATTTCTCGAGAAATGGCGCTGGTTTGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005176.5-450s21c1
Sequence:CCGGCCCTTACCTCACTTGTCTCTACTCGAGTAGAGACAAGTGAGGTAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005176.5-398s21c1
Sequence:CCGGCGACCGGAGATACTGACAGATCTCGAGATCTGTCAGTATCTCCGGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005176.5-211s21c1
Sequence:CCGGTGAGCCTTCCTTTCGCTCTTCCTCGAGGAAGAGCGAAAGGAAGGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005176.5-701s21c1
Sequence:CCGGGTAGCCTTTCTCATCCTCTTTCTCGAGAAAGAGGATGAGAAAGGCTACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000369757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005176.5-307s21c1
Sequence:CCGGGTTCGCCTGCTCCAAGTTTGTCTCGAGACAAACTTGGAGCAGGCGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005176
VALIDATED
ATP5G2 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-205s1c1
Sequence:CCGGCCCTTACCTCACTTGTCTCTACTCGAGTAGAGACAAGTGAGGTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-369s1c1
Sequence:CCGGAGGAACCCTTCTCTGAAGCAACTCGAGTTGCTTCAGAGAAGGGTTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-232s1c1
Sequence:CCGGGCTTCCAAACCAGCGCCATTTCTCGAGAAATGGCGCTGGTTTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043489    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-456s1c1
Sequence:CCGGGTAGCCTTTCTCATCCTCTTTCTCGAGAAAGAGGATGAGAAAGGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000043490    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005176.3-153s1c1
Sequence:CCGGCGACCGGAGATACTGACAGATCTCGAGATCTGTCAGTATCTCCGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005176.5-477s21c1
Sequence:CCGGGCTTCCAAACCAGCGCCATTTCTCGAGAAATGGCGCTGGTTTGGAAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005176.5-450s21c1
Sequence:CCGGCCCTTACCTCACTTGTCTCTACTCGAGTAGAGACAAGTGAGGTAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005176.5-398s21c1
Sequence:CCGGCGACCGGAGATACTGACAGATCTCGAGATCTGTCAGTATCTCCGGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005176.5-211s21c1
Sequence:CCGGTGAGCCTTCCTTTCGCTCTTCCTCGAGGAAGAGCGAAAGGAAGGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005176.5-701s21c1
Sequence:CCGGGTAGCCTTTCTCATCCTCTTTCTCGAGAAAGAGGATGAGAAAGGCTACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000369757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005176.5-307s21c1
Sequence:CCGGGTTCGCCTGCTCCAAGTTTGTCTCGAGACAAACTTGGAGCAGGCGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)