EMAIL THIS PAGE TO A FRIEND

ATP5G3

ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)

78 Gene Product Result for
Synonyms: P3
UniProtKB ID: P48201, B2R4Z0, D3DPF0, Q4ZFX7
Gene ID:
Human(518) Summary: This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene is one of three genes that encode subunit c of the proton channel. Each of the three genes have distinct mitochondrial import sequences but encode the identical mature protein. Alternatively spliced transcript variants encoding different proteins have been identified. [provided by RefSeq, Jun 2010]
Mouse(228033) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit C3 (subunit 9)
Rat(114630) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)
chicken(424142) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)
cow(540176) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)
dog(478807) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300912 Anti-ATP5G3 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
SAB4502171 Anti-ATP5G3, N-Terminal antibody produced in rabbit affinity isolated antibody rat, human
ELISA, immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001689 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001689 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001689 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU071041 MISSION® esiRNA esiRNA targeting mouse Atp5g3 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002258 Rosetta Predictions human pricing
NM_001689 Rosetta Predictions human pricing
NM_053756 Rosetta Predictions rat pricing
NM_175015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016636 predicted 711
2 SASI_Hs01_00016637 predicted 858
3 SASI_Hs01_00016638 predicted 708
4 SASI_Hs01_00016639 predicted 609
5 SASI_Hs01_00016640 predicted 788
6 SASI_Hs01_00016641 predicted 846
7 SASI_Hs01_00016642 predicted 989
8 SASI_Hs01_00016643 predicted 803
9 SASI_Hs01_00016644 predicted 908
10 SASI_Hs01_00016645 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001689 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170543 predicted 617
2 SASI_Hs01_00170544 predicted 770
3 SASI_Hs01_00170545 predicted 619
4 SASI_Hs01_00170546 predicted 518
5 SASI_Hs01_00170547 predicted 698
6 SASI_Hs01_00170548 predicted 755
7 SASI_Hs01_00170549 predicted 903
8 SASI_Hs01_00170550 predicted 717
9 SASI_Hs01_00170551 predicted 825
10 SASI_Hs01_00170552 predicted 525
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053756 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113343 predicted 281
2 SASI_Rn01_00113344 predicted 209
3 SASI_Rn01_00113345 predicted 285
4 SASI_Rn02_00266540 predicted 291
5 SASI_Rn01_00113349 predicted 433
6 SASI_Rn01_00113350 predicted 296
7 SASI_Rn02_00266541 predicted 203
8 SASI_Rn02_00266542 predicted 306
9 SASI_Rn01_00113342 predicted 442
10 SASI_Rn01_00113346 predicted 477
11 SASI_Rn01_00113341 predicted 457
12 SASI_Rn01_00113347 predicted 411
13 SASI_Rn01_00113348 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028861 predicted 380
2 SASI_Mm01_00028862 predicted 277
3 SASI_Mm01_00028863 predicted 208
4 SASI_Mm02_00345589 predicted 285
5 SASI_Mm01_00028864 predicted 288
6 SASI_Mm01_00028865 predicted 445
7 SASI_Mm01_00028866 predicted 421
8 SASI_Mm01_00028867 predicted 272
9 SASI_Mm01_00028868 predicted 382
10 SASI_Mm01_00028869 predicted 310
11 SASI_Mm01_00028860 predicted 461
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175015
VALIDATED
ATP5G3 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-181s21c1
Sequence:CCGGCAATTTCTGCATCAGTGTTATCTCGAGATAACACTGATGCAGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-391s21c1
Sequence:CCGGTCTTTGGCAGTCTTATCATTGCTCGAGCAATGATAAGACTGCCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-166s21c1
Sequence:CCGGGAGTTGCATATAGACCAATTTCTCGAGAAATTGGTCTATATGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-293s21c1
Sequence:CCGGCAGTGTAATCAGCAGAGACATCTCGAGATGTCTCTGCTGATTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-468s21c1
Sequence:CCGGTTTGCCTTGTCTGAAGCTATGCTCGAGCATAGCTTCAGACAAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175015.1-508s1c1
Sequence:CCGGGTTGCGTTCTTGATCTTGTTTCTCGAGAAACAAGATCAAGAACGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175015.1-294s1c1
Sequence:CCGGCAGTGTAATCAGCAGAGACATCTCGAGATGTCTCTGCTGATTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175015.1-167s1c1
Sequence:CCGGGAGTTGCATATAGACCAATTTCTCGAGAAATTGGTCTATATGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175015.1-325s1c1
Sequence:CCGGGCCAAATTCATTGGTGCAGGTCTCGAGACCTGCACCAATGAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175015.1-182s1c1
Sequence:CCGGCAATTTCTGCATCAGTGTTATCTCGAGATAACACTGATGCAGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175015
VALIDATED
ATP5G3 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-181s21c1
Sequence:CCGGCAATTTCTGCATCAGTGTTATCTCGAGATAACACTGATGCAGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-391s21c1
Sequence:CCGGTCTTTGGCAGTCTTATCATTGCTCGAGCAATGATAAGACTGCCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-166s21c1
Sequence:CCGGGAGTTGCATATAGACCAATTTCTCGAGAAATTGGTCTATATGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-293s21c1
Sequence:CCGGCAGTGTAATCAGCAGAGACATCTCGAGATGTCTCTGCTGATTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-468s21c1
Sequence:CCGGTTTGCCTTGTCTGAAGCTATGCTCGAGCATAGCTTCAGACAAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175015.1-508s1c1
Sequence:CCGGGTTGCGTTCTTGATCTTGTTTCTCGAGAAACAAGATCAAGAACGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175015.1-294s1c1
Sequence:CCGGCAGTGTAATCAGCAGAGACATCTCGAGATGTCTCTGCTGATTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175015.1-167s1c1
Sequence:CCGGGAGTTGCATATAGACCAATTTCTCGAGAAATTGGTCTATATGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175015.1-325s1c1
Sequence:CCGGGCCAAATTCATTGGTGCAGGTCTCGAGACCTGCACCAATGAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175015.1-182s1c1
Sequence:CCGGCAATTTCTGCATCAGTGTTATCTCGAGATAACACTGATGCAGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175015
VALIDATED
ATP5G3 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-181s21c1
Sequence:CCGGCAATTTCTGCATCAGTGTTATCTCGAGATAACACTGATGCAGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-391s21c1
Sequence:CCGGTCTTTGGCAGTCTTATCATTGCTCGAGCAATGATAAGACTGCCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303218    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-166s21c1
Sequence:CCGGGAGTTGCATATAGACCAATTTCTCGAGAAATTGGTCTATATGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-293s21c1
Sequence:CCGGCAGTGTAATCAGCAGAGACATCTCGAGATGTCTCTGCTGATTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175015.2-468s21c1
Sequence:CCGGTTTGCCTTGTCTGAAGCTATGCTCGAGCATAGCTTCAGACAAGGCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175015.1-508s1c1
Sequence:CCGGGTTGCGTTCTTGATCTTGTTTCTCGAGAAACAAGATCAAGAACGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175015.1-294s1c1
Sequence:CCGGCAGTGTAATCAGCAGAGACATCTCGAGATGTCTCTGCTGATTACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175015.1-167s1c1
Sequence:CCGGGAGTTGCATATAGACCAATTTCTCGAGAAATTGGTCTATATGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175015.1-325s1c1
Sequence:CCGGGCCAAATTCATTGGTGCAGGTCTCGAGACCTGCACCAATGAATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175015.1-182s1c1
Sequence:CCGGCAATTTCTGCATCAGTGTTATCTCGAGATAACACTGATGCAGAAATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001689
VALIDATED
ATP5G3 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001689.4-513s21c1
Sequence:CCGGGCAGCTGTTCTCATATGCTATCTCGAGATAGCATATGAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001689.4-340s21c1
Sequence:CCGGCAGCTAATCCAAAGGGAGTTTCTCGAGAAACTCCCTTTGGATTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001689.4-234s21c1
Sequence:CCGGCAGAGTTGCATACAGACCAATCTCGAGATTGGTCTGTATGCAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001689.4-448s21c1
Sequence:CCGGGCTGGTATTGGAACAGTCTTTCTCGAGAAAGACTGTTCCAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001689.4-366s21c1
Sequence:CCGGCAGTGCAATCAGCAGAGACATCTCGAGATGTCTCTGCTGATTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-587s1c1
Sequence:CCGGGCAGCTGTTCTCATATGCTATCTCGAGATAGCATATGAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-414s1c1
Sequence:CCGGCAGCTAATCCAAAGGGAGTTTCTCGAGAAACTCCCTTTGGATTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-308s1c1
Sequence:CCGGCAGAGTTGCATACAGACCAATCTCGAGATTGGTCTGTATGCAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-440s1c1
Sequence:CCGGCAGTGCAATCAGCAGAGACATCTCGAGATGTCTCTGCTGATTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-522s1c1
Sequence:CCGGGCTGGTATTGGAACAGTCTTTCTCGAGAAAGACTGTTCCAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001689
VALIDATED
ATP5G3 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001689.4-513s21c1
Sequence:CCGGGCAGCTGTTCTCATATGCTATCTCGAGATAGCATATGAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001689.4-340s21c1
Sequence:CCGGCAGCTAATCCAAAGGGAGTTTCTCGAGAAACTCCCTTTGGATTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001689.4-234s21c1
Sequence:CCGGCAGAGTTGCATACAGACCAATCTCGAGATTGGTCTGTATGCAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001689.4-448s21c1
Sequence:CCGGGCTGGTATTGGAACAGTCTTTCTCGAGAAAGACTGTTCCAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001689.4-366s21c1
Sequence:CCGGCAGTGCAATCAGCAGAGACATCTCGAGATGTCTCTGCTGATTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-587s1c1
Sequence:CCGGGCAGCTGTTCTCATATGCTATCTCGAGATAGCATATGAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-414s1c1
Sequence:CCGGCAGCTAATCCAAAGGGAGTTTCTCGAGAAACTCCCTTTGGATTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-308s1c1
Sequence:CCGGCAGAGTTGCATACAGACCAATCTCGAGATTGGTCTGTATGCAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-440s1c1
Sequence:CCGGCAGTGCAATCAGCAGAGACATCTCGAGATGTCTCTGCTGATTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-522s1c1
Sequence:CCGGGCTGGTATTGGAACAGTCTTTCTCGAGAAAGACTGTTCCAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001689
VALIDATED
ATP5G3 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C3 (subunit 9)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001689.4-513s21c1
Sequence:CCGGGCAGCTGTTCTCATATGCTATCTCGAGATAGCATATGAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001689.4-340s21c1
Sequence:CCGGCAGCTAATCCAAAGGGAGTTTCTCGAGAAACTCCCTTTGGATTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291029    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001689.4-234s21c1
Sequence:CCGGCAGAGTTGCATACAGACCAATCTCGAGATTGGTCTGTATGCAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001689.4-448s21c1
Sequence:CCGGGCTGGTATTGGAACAGTCTTTCTCGAGAAAGACTGTTCCAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001689.4-366s21c1
Sequence:CCGGCAGTGCAATCAGCAGAGACATCTCGAGATGTCTCTGCTGATTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-587s1c1
Sequence:CCGGGCAGCTGTTCTCATATGCTATCTCGAGATAGCATATGAGAACAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-414s1c1
Sequence:CCGGCAGCTAATCCAAAGGGAGTTTCTCGAGAAACTCCCTTTGGATTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043515    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-308s1c1
Sequence:CCGGCAGAGTTGCATACAGACCAATCTCGAGATTGGTCTGTATGCAACTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043514    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-440s1c1
Sequence:CCGGCAGTGCAATCAGCAGAGACATCTCGAGATGTCTCTGCTGATTGCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_001689.1-522s1c1
Sequence:CCGGGCTGGTATTGGAACAGTCTTTCTCGAGAAAGACTGTTCCAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks