EMAIL THIS PAGE TO A FRIEND

ATP5H

ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d

82 Gene Product Result for
Synonyms: ATPQ
UniProtKB ID: O75947, B2R5L6, Q9H3J4
Gene ID:
Human(10476) Summary: Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the d subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. In addition, three pseudogenes are located on chromosomes 9, 12 and 15. [provided by RefSeq, Jun 2010]
Mouse(71679) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d
Rat(641434) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
Zebrafish(393675) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit d
chicken(422115) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
domestic cat(101097436) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
cow(282710) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
naked mole-rat(101706195) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
domestic guinea pig(100726169) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
sheep(100217408) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006356 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006356 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006356 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003785 Rosetta Predictions human pricing
NM_006356 Rosetta Predictions human pricing
NM_019383 Rosetta Predictions rat pricing
NM_027862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003785 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00304370 predicted 321
2 SASI_Hs01_00216042 predicted 208
3 SASI_Hs01_00216045 predicted 310
4 SASI_Hs01_00216046 predicted 316
5 SASI_Hs02_00304371 predicted 305
6 SASI_Hs02_00304372 predicted 212
7 SASI_Hs02_00304373 predicted 316
8 SASI_Hs01_00216037 predicted 300
9 SASI_Hs01_00216038 predicted 208
10 SASI_Hs01_00216039 predicted 222
11 SASI_Hs01_00216040 predicted 302
12 SASI_Hs01_00216041 predicted 209
13 SASI_Hs01_00216043 predicted 252
14 SASI_Hs01_00216044 predicted 245
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035606 predicted 298
2 SASI_Hs01_00035607 predicted 319
3 SASI_Hs02_00341402 predicted 293
4 SASI_Hs02_00341403 predicted 293
5 SASI_Hs01_00035611 predicted 207
6 SASI_Hs02_00341404 predicted 326
7 SASI_Hs01_00035615 predicted 389
8 SASI_Hs02_00341405 predicted 388
9 SASI_Hs02_00341406 predicted 298
10 SASI_Hs02_00341407 predicted 386
11 SASI_Hs01_00035608 predicted 208
12 SASI_Hs01_00035609 predicted 222
13 SASI_Hs01_00035610 predicted 372
14 SASI_Hs01_00035612 predicted 274
15 SASI_Hs01_00035613 predicted 252
16 SASI_Hs01_00035614 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055989 predicted 375
2 SASI_Rn01_00055992 predicted 198
3 SASI_Rn02_00262425 predicted 353
4 SASI_Rn02_00262426 predicted 371
5 SASI_Rn01_00055995 predicted 374
6 SASI_Rn01_00055996 predicted 353
7 SASI_Rn02_00262427 predicted 307
8 SASI_Rn01_00055997 predicted 349
9 SASI_Rn01_00055998 predicted 361
10 SASI_Rn02_00262428 predicted 376
11 SASI_Rn01_00055990 predicted 200
12 SASI_Rn01_00055991 predicted 209
13 SASI_Rn01_00055993 predicted 217
14 SASI_Rn01_00055994 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332816 predicted 222
2 SASI_Mm02_00332817 predicted 274
3 SASI_Mm02_00332818 predicted 265
4 SASI_Mm02_00332819 predicted 216
5 SASI_Mm02_00332820 predicted 269
6 SASI_Mm02_00332821 predicted 273
7 SASI_Mm01_00186237 predicted 326
8 SASI_Mm01_00186238 predicted 320
9 SASI_Mm02_00332822 predicted 334
10 SASI_Mm01_00186239 predicted 326
11 SASI_Mm01_00186235 predicted 345
12 SASI_Mm01_00186236 predicted 347
13 SASI_Mm01_00186240 predicted 326
14 SASI_Mm01_00186241 predicted 187
15 SASI_Mm01_00186242 predicted 191
16 SASI_Mm01_00186243 predicted 423
17 SASI_Mm01_00186244 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027862
VALIDATED
ATP5H MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-416s1c1
Sequence:CCGGCCCTTTGACCAGATGACCATTCTCGAGAATGGTCATCTGGTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-160s1c1
Sequence:CCGGGTTGGCTAGTCTGTCTGAGAACTCGAGTTCTCAGACAGACTAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-424s1c1
Sequence:CCGGCCAGATGACCATTGATGACTTCTCGAGAAGTCATCAATGGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-253s1c1
Sequence:CCGGGAAGTATAATGCCCTGAAGATCTCGAGATCTTCAGGGCATTATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027862.1-160s21c1
Sequence:CCGGGTTGGCTAGTCTGTCTGAGAACTCGAGTTCTCAGACAGACTAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027862.1-339s21c1
Sequence:CCGGGTGCTGAGTTTGTGTCTGGATCTCGAGATCCAGACACAAACTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027862.1-416s21c1
Sequence:CCGGCCCTTTGACCAGATGACCATTCTCGAGAATGGTCATCTGGTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-339s1c2
Sequence:CCGGGTGCTGAGTTTGTGTCTGGATCTCGAGATCCAGACACAAACTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027862.1-424s21c1
Sequence:CCGGCCAGATGACCATTGATGACTTCTCGAGAAGTCATCAATGGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027862
VALIDATED
ATP5H MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-416s1c1
Sequence:CCGGCCCTTTGACCAGATGACCATTCTCGAGAATGGTCATCTGGTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-160s1c1
Sequence:CCGGGTTGGCTAGTCTGTCTGAGAACTCGAGTTCTCAGACAGACTAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-424s1c1
Sequence:CCGGCCAGATGACCATTGATGACTTCTCGAGAAGTCATCAATGGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-253s1c1
Sequence:CCGGGAAGTATAATGCCCTGAAGATCTCGAGATCTTCAGGGCATTATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027862.1-160s21c1
Sequence:CCGGGTTGGCTAGTCTGTCTGAGAACTCGAGTTCTCAGACAGACTAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027862.1-339s21c1
Sequence:CCGGGTGCTGAGTTTGTGTCTGGATCTCGAGATCCAGACACAAACTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027862.1-416s21c1
Sequence:CCGGCCCTTTGACCAGATGACCATTCTCGAGAATGGTCATCTGGTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-339s1c2
Sequence:CCGGGTGCTGAGTTTGTGTCTGGATCTCGAGATCCAGACACAAACTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027862.1-424s21c1
Sequence:CCGGCCAGATGACCATTGATGACTTCTCGAGAAGTCATCAATGGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027862
VALIDATED
ATP5H MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076103    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-416s1c1
Sequence:CCGGCCCTTTGACCAGATGACCATTCTCGAGAATGGTCATCTGGTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-160s1c1
Sequence:CCGGGTTGGCTAGTCTGTCTGAGAACTCGAGTTCTCAGACAGACTAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-424s1c1
Sequence:CCGGCCAGATGACCATTGATGACTTCTCGAGAAGTCATCAATGGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-253s1c1
Sequence:CCGGGAAGTATAATGCCCTGAAGATCTCGAGATCTTCAGGGCATTATACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027862.1-160s21c1
Sequence:CCGGGTTGGCTAGTCTGTCTGAGAACTCGAGTTCTCAGACAGACTAGCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027862.1-339s21c1
Sequence:CCGGGTGCTGAGTTTGTGTCTGGATCTCGAGATCCAGACACAAACTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027862.1-416s21c1
Sequence:CCGGCCCTTTGACCAGATGACCATTCTCGAGAATGGTCATCTGGTCAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027862.1-339s1c2
Sequence:CCGGGTGCTGAGTTTGTGTCTGGATCTCGAGATCCAGACACAAACTCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027862.1-424s21c1
Sequence:CCGGCCAGATGACCATTGATGACTTCTCGAGAAGTCATCAATGGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006356
VALIDATED
ATP5H MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006356.1-122s1c1
Sequence:CCGGCCATTGCTAGTTCCCTGAAATCTCGAGATTTCAGGGAACTAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006356.1-283s1c1
Sequence:CCGGCCCGTGCCAGAGGATAAATATCTCGAGATATTTATCCTCTGGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006356.1-460s1c1
Sequence:CCGGGCTTTCCCAGAAACCAAATTACTCGAGTAATTTGGTTTCTGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006356.1-205s1c1
Sequence:CCGGTGGGCTTACTACAAGGCCAATCTCGAGATTGGCCTTGTAGTAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006356.1-258s1c1
Sequence:CCGGGAAGAAGTTTAATGCGCTGAACTCGAGTTCAGCGCATTAAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-224s21c1
Sequence:CCGGTGGGCTTACTACAAGGCCAATCTCGAGATTGGCCTTGTAGTAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-302s21c1
Sequence:CCGGCCCGTGCCAGAGGATAAATATCTCGAGATATTTATCCTCTGGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-479s21c1
Sequence:CCGGGCTTTCCCAGAAACCAAATTACTCGAGTAATTTGGTTTCTGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-141s21c1
Sequence:CCGGCCATTGCTAGTTCCCTGAAATCTCGAGATTTCAGGGAACTAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-277s21c1
Sequence:CCGGGAAGAAGTTTAATGCGCTGAACTCGAGTTCAGCGCATTAAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006356
VALIDATED
ATP5H MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006356.1-122s1c1
Sequence:CCGGCCATTGCTAGTTCCCTGAAATCTCGAGATTTCAGGGAACTAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006356.1-283s1c1
Sequence:CCGGCCCGTGCCAGAGGATAAATATCTCGAGATATTTATCCTCTGGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006356.1-460s1c1
Sequence:CCGGGCTTTCCCAGAAACCAAATTACTCGAGTAATTTGGTTTCTGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006356.1-205s1c1
Sequence:CCGGTGGGCTTACTACAAGGCCAATCTCGAGATTGGCCTTGTAGTAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006356.1-258s1c1
Sequence:CCGGGAAGAAGTTTAATGCGCTGAACTCGAGTTCAGCGCATTAAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-224s21c1
Sequence:CCGGTGGGCTTACTACAAGGCCAATCTCGAGATTGGCCTTGTAGTAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-302s21c1
Sequence:CCGGCCCGTGCCAGAGGATAAATATCTCGAGATATTTATCCTCTGGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-479s21c1
Sequence:CCGGGCTTTCCCAGAAACCAAATTACTCGAGTAATTTGGTTTCTGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-141s21c1
Sequence:CCGGCCATTGCTAGTTCCCTGAAATCTCGAGATTTCAGGGAACTAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-277s21c1
Sequence:CCGGGAAGAAGTTTAATGCGCTGAACTCGAGTTCAGCGCATTAAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006356
VALIDATED
ATP5H MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit d
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038304    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006356.1-122s1c1
Sequence:CCGGCCATTGCTAGTTCCCTGAAATCTCGAGATTTCAGGGAACTAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038305    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006356.1-283s1c1
Sequence:CCGGCCCGTGCCAGAGGATAAATATCTCGAGATATTTATCCTCTGGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006356.1-460s1c1
Sequence:CCGGGCTTTCCCAGAAACCAAATTACTCGAGTAATTTGGTTTCTGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038308    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006356.1-205s1c1
Sequence:CCGGTGGGCTTACTACAAGGCCAATCTCGAGATTGGCCTTGTAGTAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038306    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006356.1-258s1c1
Sequence:CCGGGAAGAAGTTTAATGCGCTGAACTCGAGTTCAGCGCATTAAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-224s21c1
Sequence:CCGGTGGGCTTACTACAAGGCCAATCTCGAGATTGGCCTTGTAGTAAGCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-302s21c1
Sequence:CCGGCCCGTGCCAGAGGATAAATATCTCGAGATATTTATCCTCTGGCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-479s21c1
Sequence:CCGGGCTTTCCCAGAAACCAAATTACTCGAGTAATTTGGTTTCTGGGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-141s21c1
Sequence:CCGGCCATTGCTAGTTCCCTGAAATCTCGAGATTTCAGGGAACTAGCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291601    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006356.2-277s21c1
Sequence:CCGGGAAGAAGTTTAATGCGCTGAACTCGAGTTCAGCGCATTAAACTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks