EMAIL THIS PAGE TO A FRIEND

ATP5J2

ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2

82 Gene Product Result for
Synonyms: ATP5JL
Gene ID:
Human(9551) Summary: Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The catalytic portion of mitochondrial ATP synthase consists of five different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and single representatives of the gamma, delta, and epsilon subunits. The proton channel likely has nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the f subunit of the Fo complex. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. This gene has multiple pseudogenes. Naturally occurring read-through transcription also exists between this gene and the downstream pentatricopeptide repeat domain 1 (PTCD1) gene. [provided by RefSeq, Nov 2010]
Mouse(57423) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F2
Rat(690441) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2
Zebrafish(503957) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2
cow(506492) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2
dog(479742) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2
chicken(416495) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020582 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020582 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020582 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004889 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004889 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004889 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003713 Rosetta Predictions human pricing
NM_001003714 Rosetta Predictions human pricing
NM_001039178 Rosetta Predictions human pricing
NM_004889 Rosetta Predictions human pricing
XM_001074466 Rosetta Predictions rat pricing
NM_020582 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026434 predicted 227
2 SASI_Hs01_00026435 predicted 233
3 SASI_Hs01_00026436 predicted 229
4 SASI_Hs01_00026437 predicted 246
5 SASI_Hs01_00026438 predicted 231
6 SASI_Hs01_00026439 predicted 242
7 SASI_Hs01_00026440 predicted 238
8 SASI_Hs01_00026441 predicted 224
9 SASI_Hs01_00026442 predicted 225
10 SASI_Hs01_00026443 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003714 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088604 predicted 186
2 SASI_Hs01_00088605 predicted 112
3 SASI_Hs02_00304349 predicted 277
4 SASI_Hs01_00088610 predicted 268
5 SASI_Hs02_00304350 predicted 186
6 SASI_Hs02_00304351 predicted 125
7 SASI_Hs01_00088612 predicted 181
8 SASI_Hs01_00088613 predicted 166
9 SASI_Hs02_00304352 predicted 263
10 SASI_Hs02_00304353 predicted 180
11 SASI_Hs01_00088606 predicted 309
12 SASI_Hs01_00088607 predicted 140
13 SASI_Hs01_00088608 predicted 287
14 SASI_Hs01_00088609 predicted 71
15 SASI_Hs01_00088611 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166566 predicted 93
2 SASI_Hs01_00166568 predicted 259
3 SASI_Hs01_00166571 predicted 250
4 SASI_Hs02_00308442 predicted 105
5 SASI_Hs01_00166573 predicted 45
6 SASI_Hs01_00166574 predicted 49
7 SASI_Hs02_00308443 predicted 248
8 SASI_Hs02_00308444 predicted 179
9 SASI_Hs02_00308445 predicted 184
10 SASI_Hs01_00166567 predicted 294
11 SASI_Hs01_00166569 predicted 121
12 SASI_Hs01_00166570 predicted 269
13 SASI_Hs01_00166572 predicted 125
14 SASI_Hs01_00166575 predicted 286
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004889 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079509 predicted 252
2 SASI_Hs01_00079510 predicted 251
3 SASI_Hs01_00079511 predicted 255
4 SASI_Hs01_00079513 predicted 262
5 SASI_Hs01_00079514 predicted 247
6 SASI_Hs01_00079515 predicted 255
7 SASI_Hs01_00079516 predicted 265
8 SASI_Hs01_00079517 predicted 244
9 SASI_Hs01_00079518 predicted 245
10 SASI_Hs02_00338526 predicted 243
11 SASI_Hs01_00079512 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00346338 predicted 200
2 SASI_Rn02_00346339 predicted 200
3 SASI_Rn02_00346340 predicted 203
4 SASI_Rn02_00346341 predicted 199
5 SASI_Rn02_00346342 predicted 200
6 SASI_Rn02_00346343 predicted 103
7 SASI_Rn02_00346344 predicted 317
8 SASI_Rn02_00346345 predicted 35
9 SASI_Rn02_00346346 predicted 156
10 SASI_Rn02_00346347 predicted 44
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158705 predicted 203
2 SASI_Mm01_00158706 predicted 197
3 SASI_Mm01_00158708 predicted 195
4 SASI_Mm01_00158709 predicted 216
5 SASI_Mm01_00158710 predicted 215
6 SASI_Mm01_00158711 predicted 199
7 SASI_Mm01_00158712 predicted 194
8 SASI_Mm02_00325651 predicted 113
9 SASI_Mm02_00325652 predicted 81
10 SASI_Mm01_00158707 predicted 199
11 SASI_Mm01_00158713 predicted 139
12 SASI_Mm01_00158714 predicted 194
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020582
VALIDATED
ATP5J2 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-134s21c1
Sequence:CCGGGCTGCCGAGCTGGATAATGATCTCGAGATCATTATCCAGCTCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-142s21c1
Sequence:CCGGGCTGGATAATGATGCGGGATTCTCGAGAATCCCGCATCATTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020582.1-135s1c2
Sequence:CCGGGCTGCCGAGCTGGATAATGATCTCGAGATCATTATCCAGCTCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-287s21c1
Sequence:CCGGCAGCTACTGCATTTCTTACAACTCGAGTTGTAAGAAATGCAGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-296s21c1
Sequence:CCGGCATTTCTTACAAGGAACTCAACTCGAGTTGAGTTCCTTGTAAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-206s21c1
Sequence:CCGGCCGGTATTACAACAAGTACATCTCGAGATGTACTTGTTGTAATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020582.1-207s1c1
Sequence:CCGGCCGGTATTACAACAAGTACATCTCGAGATGTACTTGTTGTAATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020582.1-143s1c1
Sequence:CCGGGCTGGATAATGATGCGGGATTCTCGAGAATCCCGCATCATTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020582.1-288s1c1
Sequence:CCGGCAGCTACTGCATTTCTTACAACTCGAGTTGTAAGAAATGCAGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020582.1-297s1c1
Sequence:CCGGCATTTCTTACAAGGAACTCAACTCGAGTTGAGTTCCTTGTAAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020582
VALIDATED
ATP5J2 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-134s21c1
Sequence:CCGGGCTGCCGAGCTGGATAATGATCTCGAGATCATTATCCAGCTCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-142s21c1
Sequence:CCGGGCTGGATAATGATGCGGGATTCTCGAGAATCCCGCATCATTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020582.1-135s1c2
Sequence:CCGGGCTGCCGAGCTGGATAATGATCTCGAGATCATTATCCAGCTCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-287s21c1
Sequence:CCGGCAGCTACTGCATTTCTTACAACTCGAGTTGTAAGAAATGCAGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-296s21c1
Sequence:CCGGCATTTCTTACAAGGAACTCAACTCGAGTTGAGTTCCTTGTAAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-206s21c1
Sequence:CCGGCCGGTATTACAACAAGTACATCTCGAGATGTACTTGTTGTAATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020582.1-207s1c1
Sequence:CCGGCCGGTATTACAACAAGTACATCTCGAGATGTACTTGTTGTAATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020582.1-143s1c1
Sequence:CCGGGCTGGATAATGATGCGGGATTCTCGAGAATCCCGCATCATTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020582.1-288s1c1
Sequence:CCGGCAGCTACTGCATTTCTTACAACTCGAGTTGTAAGAAATGCAGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020582.1-297s1c1
Sequence:CCGGCATTTCTTACAAGGAACTCAACTCGAGTTGAGTTCCTTGTAAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020582
VALIDATED
ATP5J2 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-134s21c1
Sequence:CCGGGCTGCCGAGCTGGATAATGATCTCGAGATCATTATCCAGCTCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-142s21c1
Sequence:CCGGGCTGGATAATGATGCGGGATTCTCGAGAATCCCGCATCATTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020582.1-135s1c2
Sequence:CCGGGCTGCCGAGCTGGATAATGATCTCGAGATCATTATCCAGCTCGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-287s21c1
Sequence:CCGGCAGCTACTGCATTTCTTACAACTCGAGTTGTAAGAAATGCAGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-296s21c1
Sequence:CCGGCATTTCTTACAAGGAACTCAACTCGAGTTGAGTTCCTTGTAAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020582.2-206s21c1
Sequence:CCGGCCGGTATTACAACAAGTACATCTCGAGATGTACTTGTTGTAATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020582.1-207s1c1
Sequence:CCGGCCGGTATTACAACAAGTACATCTCGAGATGTACTTGTTGTAATACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076154    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020582.1-143s1c1
Sequence:CCGGGCTGGATAATGATGCGGGATTCTCGAGAATCCCGCATCATTATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020582.1-288s1c1
Sequence:CCGGCAGCTACTGCATTTCTTACAACTCGAGTTGTAAGAAATGCAGTAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020582.1-297s1c1
Sequence:CCGGCATTTCTTACAAGGAACTCAACTCGAGTTGAGTTCCTTGTAAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004889
VALIDATED
ATP5J2 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-174s1c1
Sequence:CCGGCCGGTACTACAACAAGTACATCTCGAGATGTACTTGTTGTAGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-58s1c1
Sequence:CCGGGTACCAGTGAAGGACAAGAAACTCGAGTTTCTTGTCCTTCACTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-246s1c1
Sequence:CCGGCGTGCTCTTTAGCTACTCCTTCTCGAGAAGGAGTAGCTAAAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-150s1c1
Sequence:CCGGCGGAGCGTTTCAAAGAGGTTACTCGAGTAACCTCTTTGAAACGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-111s1c1
Sequence:CCGGCTGGATCTTGATGCGGGACTTCTCGAGAAGTCCCGCATCAAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004889
VALIDATED
ATP5J2 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-174s1c1
Sequence:CCGGCCGGTACTACAACAAGTACATCTCGAGATGTACTTGTTGTAGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-58s1c1
Sequence:CCGGGTACCAGTGAAGGACAAGAAACTCGAGTTTCTTGTCCTTCACTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-246s1c1
Sequence:CCGGCGTGCTCTTTAGCTACTCCTTCTCGAGAAGGAGTAGCTAAAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-150s1c1
Sequence:CCGGCGGAGCGTTTCAAAGAGGTTACTCGAGTAACCTCTTTGAAACGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-111s1c1
Sequence:CCGGCTGGATCTTGATGCGGGACTTCTCGAGAAGTCCCGCATCAAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004889
VALIDATED
ATP5J2 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-174s1c1
Sequence:CCGGCCGGTACTACAACAAGTACATCTCGAGATGTACTTGTTGTAGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-58s1c1
Sequence:CCGGGTACCAGTGAAGGACAAGAAACTCGAGTTTCTTGTCCTTCACTGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-246s1c1
Sequence:CCGGCGTGCTCTTTAGCTACTCCTTCTCGAGAAGGAGTAGCTAAAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-150s1c1
Sequence:CCGGCGGAGCGTTTCAAAGAGGTTACTCGAGTAACCTCTTTGAAACGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004889.1-111s1c1
Sequence:CCGGCTGGATCTTGATGCGGGACTTCTCGAGAAGTCCCGCATCAAGATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks