EMAIL THIS PAGE TO A FRIEND

ATP5J

ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6

114 Gene Product Result for
Synonyms: ATP5 ATP5A ATPM CF6 F6
UniProtKB ID: P18859, J3KQ83
Gene ID:
Human(522) Summary: Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the F6 subunit of the Fo complex, required for F1 and Fo interactions. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene. A pseudogene exists on chromosome Yp11.[provided by RefSeq, Jun 2010]
Mouse(11957) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F
Rat(94271) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
Zebrafish(406599) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit F6
cow(282690) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
domestic cat(101099742) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
dog(478393) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
chicken(418477) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
sheep(101113030) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
naked mole-rat(101723785) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
domestic guinea pig(100715872) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001685 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001685 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001685 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003696 Rosetta Predictions human pricing
NM_001003697 Rosetta Predictions human pricing
NM_001003701 Rosetta Predictions human pricing
NM_001003703 Rosetta Predictions human pricing
NM_001685 Rosetta Predictions human pricing
NM_053602 Rosetta Predictions rat pricing
NM_016755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00063454 predicted 594
2 SASI_Hs01_00063456 predicted 578
3 SASI_Hs01_00063458 predicted 599
4 SASI_Hs01_00063459 predicted 590
5 SASI_Hs01_00063460 predicted 586
6 SASI_Hs01_00063461 predicted 592
7 SASI_Hs02_00304325 predicted 586
8 SASI_Hs02_00304326 predicted 583
9 SASI_Hs02_00304327 predicted 585
10 SASI_Hs02_00304328 predicted 571
11 SASI_Hs01_00063453 predicted 610
12 SASI_Hs01_00063455 predicted 613
13 SASI_Hs01_00063457 predicted 598
14 SASI_Hs01_00063462 predicted 614
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023907 predicted 414
2 SASI_Hs01_00023909 predicted 397
3 SASI_Hs01_00023911 predicted 429
4 SASI_Hs01_00023912 predicted 413
5 SASI_Hs01_00023913 predicted 415
6 SASI_Hs01_00023914 predicted 417
7 SASI_Hs02_00304329 predicted 421
8 SASI_Hs02_00304330 predicted 418
9 SASI_Hs02_00304331 predicted 404
10 SASI_Hs02_00304332 predicted 404
11 SASI_Hs01_00023906 predicted 443
12 SASI_Hs01_00023908 predicted 436
13 SASI_Hs01_00023910 predicted 429
14 SASI_Hs01_00023915 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201148 predicted 963
2 SASI_Hs01_00201150 predicted 949
3 SASI_Hs01_00201152 predicted 977
4 SASI_Hs01_00201153 predicted 962
5 SASI_Hs01_00201154 predicted 962
6 SASI_Hs01_00201155 predicted 960
7 SASI_Hs02_00304337 predicted 962
8 SASI_Hs02_00304338 predicted 958
9 SASI_Hs02_00304339 predicted 955
10 SASI_Hs02_00304340 predicted 948
11 SASI_Hs01_00201147 predicted 989
12 SASI_Hs01_00201149 predicted 990
13 SASI_Hs01_00201151 predicted 975
14 SASI_Hs01_00201156 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237307 predicted 1054
2 SASI_Hs01_00237309 predicted 1036
3 SASI_Hs01_00237311 predicted 1069
4 SASI_Hs01_00237312 predicted 1045
5 SASI_Hs01_00237313 predicted 1043
6 SASI_Hs01_00237314 predicted 1050
7 SASI_Hs02_00304343 predicted 1051
8 SASI_Hs02_00304344 predicted 1050
9 SASI_Hs02_00304345 predicted 1044
10 SASI_Hs02_00304346 predicted 1039
11 SASI_Hs01_00237306 predicted 1079
12 SASI_Hs01_00237308 predicted 1069
13 SASI_Hs01_00237310 predicted 1064
14 SASI_Hs01_00237315 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001685 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056934 predicted 917
2 SASI_Hs01_00056936 predicted 898
3 SASI_Hs01_00056938 predicted 929
4 SASI_Hs01_00056939 predicted 916
5 SASI_Hs01_00056940 predicted 911
6 SASI_Hs01_00056941 predicted 910
7 SASI_Hs02_00332340 predicted 921
8 SASI_Hs02_00332341 predicted 916
9 SASI_Hs02_00332342 predicted 904
10 SASI_Hs02_00332343 predicted 900
11 SASI_Hs01_00056933 predicted 934
12 SASI_Hs01_00056935 predicted 939
13 SASI_Hs01_00056937 predicted 930
14 SASI_Hs01_00056942 predicted 942
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053602 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038439 predicted 269
2 SASI_Rn01_00038440 predicted 326
3 SASI_Rn02_00266290 predicted 222
4 SASI_Rn01_00038442 predicted 319
5 SASI_Rn01_00038443 predicted 240
6 SASI_Rn01_00038444 predicted 248
7 SASI_Rn01_00038446 predicted 234
8 SASI_Rn01_00038447 predicted 289
9 SASI_Rn01_00038448 predicted 229
10 SASI_Rn02_00266291 predicted 251
11 SASI_Rn01_00038441 predicted 256
12 SASI_Rn01_00038445 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100958 predicted 438
2 SASI_Mm01_00100959 predicted 502
3 SASI_Mm01_00100960 predicted 501
4 SASI_Mm01_00100961 predicted 424
5 SASI_Mm01_00100962 predicted 422
6 SASI_Mm01_00100963 predicted 437
7 SASI_Mm01_00100964 predicted 481
8 SASI_Mm01_00100965 predicted 380
9 SASI_Mm01_00100967 predicted 402
10 SASI_Mm02_00323491 predicted 469
11 SASI_Mm01_00100966 predicted 466
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001685
VALIDATED
ATP5J MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001685.3-801s1c1
Sequence:CCGGGATCCTATACAGAAACTCTTTCTCGAGAAAGAGTTTCTGTATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001685.3-777s1c1
Sequence:CCGGGCAGTGGCATTTAATAAGGAACTCGAGTTCCTTATTAAATGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001685.3-984s1c1
Sequence:CCGGCCCAAATTTGAAGTCATCGAACTCGAGTTCGATGACTTCAAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001685.3-963s1c1
Sequence:CCGGCCCACCTTCAAATTTGAAGATCTCGAGATCTTCAAATTTGAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001685.3-865s1c1
Sequence:CCGGGAGGACCTGTTGATGCTAGTTCTCGAGAACTAGCATCAACAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001685.4-846s21c1
Sequence:CCGGGAGGACCTGTTGATGCTAGTTCTCGAGAACTAGCATCAACAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001685.4-965s21c1
Sequence:CCGGCCCAAATTTGAAGTCATCGAACTCGAGTTCGATGACTTCAAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001685.4-782s21c1
Sequence:CCGGGATCCTATACAGAAACTCTTTCTCGAGAAAGAGTTTCTGTATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001685.4-758s21c1
Sequence:CCGGGCAGTGGCATTTAATAAGGAACTCGAGTTCCTTATTAAATGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001685
VALIDATED
ATP5J MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001685.3-801s1c1
Sequence:CCGGGATCCTATACAGAAACTCTTTCTCGAGAAAGAGTTTCTGTATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001685.3-777s1c1
Sequence:CCGGGCAGTGGCATTTAATAAGGAACTCGAGTTCCTTATTAAATGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001685.3-984s1c1
Sequence:CCGGCCCAAATTTGAAGTCATCGAACTCGAGTTCGATGACTTCAAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001685.3-963s1c1
Sequence:CCGGCCCACCTTCAAATTTGAAGATCTCGAGATCTTCAAATTTGAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001685.3-865s1c1
Sequence:CCGGGAGGACCTGTTGATGCTAGTTCTCGAGAACTAGCATCAACAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001685.4-846s21c1
Sequence:CCGGGAGGACCTGTTGATGCTAGTTCTCGAGAACTAGCATCAACAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001685.4-965s21c1
Sequence:CCGGCCCAAATTTGAAGTCATCGAACTCGAGTTCGATGACTTCAAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001685.4-782s21c1
Sequence:CCGGGATCCTATACAGAAACTCTTTCTCGAGAAAGAGTTTCTGTATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001685.4-758s21c1
Sequence:CCGGGCAGTGGCATTTAATAAGGAACTCGAGTTCCTTATTAAATGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001685
VALIDATED
ATP5J MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001685.3-801s1c1
Sequence:CCGGGATCCTATACAGAAACTCTTTCTCGAGAAAGAGTTTCTGTATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001685.3-777s1c1
Sequence:CCGGGCAGTGGCATTTAATAAGGAACTCGAGTTCCTTATTAAATGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001685.3-984s1c1
Sequence:CCGGCCCAAATTTGAAGTCATCGAACTCGAGTTCGATGACTTCAAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001685.3-963s1c1
Sequence:CCGGCCCACCTTCAAATTTGAAGATCTCGAGATCTTCAAATTTGAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001685.3-865s1c1
Sequence:CCGGGAGGACCTGTTGATGCTAGTTCTCGAGAACTAGCATCAACAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001685.4-846s21c1
Sequence:CCGGGAGGACCTGTTGATGCTAGTTCTCGAGAACTAGCATCAACAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001685.4-965s21c1
Sequence:CCGGCCCAAATTTGAAGTCATCGAACTCGAGTTCGATGACTTCAAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001685.4-782s21c1
Sequence:CCGGGATCCTATACAGAAACTCTTTCTCGAGAAAGAGTTTCTGTATAGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_001685.4-758s21c1
Sequence:CCGGGCAGTGGCATTTAATAAGGAACTCGAGTTCCTTATTAAATGCCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016755
ATP5J MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-399s1c1
Sequence:CCGGGTGCATTTGAAGAGGAACATTCTCGAGAATGTTCCTCTTCAAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-615s1c1
Sequence:CCGGCCTACCTTCAAATTTGATGATCTCGAGATCATCAAATTTGAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-432s1c1
Sequence:CCGGGTGGCCTTTAATAAGGAACTTCTCGAGAAGTTCCTTATTAAAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-429s1c1
Sequence:CCGGGCTGTGGCCTTTAATAAGGAACTCGAGTTCCTTATTAAAGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-461s1c2
Sequence:CCGGACAGAAACTCTTCGTGGACAACTCGAGTTGTCCACGAAGAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016755
ATP5J MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-399s1c1
Sequence:CCGGGTGCATTTGAAGAGGAACATTCTCGAGAATGTTCCTCTTCAAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-615s1c1
Sequence:CCGGCCTACCTTCAAATTTGATGATCTCGAGATCATCAAATTTGAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-432s1c1
Sequence:CCGGGTGGCCTTTAATAAGGAACTTCTCGAGAAGTTCCTTATTAAAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-429s1c1
Sequence:CCGGGCTGTGGCCTTTAATAAGGAACTCGAGTTCCTTATTAAAGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-461s1c2
Sequence:CCGGACAGAAACTCTTCGTGGACAACTCGAGTTGTCCACGAAGAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016755
ATP5J MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit F6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-399s1c1
Sequence:CCGGGTGCATTTGAAGAGGAACATTCTCGAGAATGTTCCTCTTCAAATGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-615s1c1
Sequence:CCGGCCTACCTTCAAATTTGATGATCTCGAGATCATCAAATTTGAAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-432s1c1
Sequence:CCGGGTGGCCTTTAATAAGGAACTTCTCGAGAAGTTCCTTATTAAAGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-429s1c1
Sequence:CCGGGCTGTGGCCTTTAATAAGGAACTCGAGTTCCTTATTAAAGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222643    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016755.2-461s1c2
Sequence:CCGGACAGAAACTCTTCGTGGACAACTCGAGTTGTCCACGAAGAGTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks