EMAIL THIS PAGE TO A FRIEND

ATP5L2

ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G2

24 Gene Product Result for
Synonyms: ATP5K2
UniProtKB ID: Q7Z4Y8
Gene ID:
Mouse(100040708) ATP synthase, H+ transporting, mitochondrial FO complex, subunit G2, pseudogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001165877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001165877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001165877 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001111335 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001111335 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001111335 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001111335 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001111335 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00306854 predicted 193
2 SASI_Mm02_00306855 predicted 193
3 SASI_Mm02_00306856 predicted 349
4 SASI_Mm02_00306857 predicted 314
5 SASI_Mm02_00306858 predicted 213
6 SASI_Mm02_00306859 predicted 149
7 SASI_Mm02_00306860 predicted 300
8 SASI_Mm02_00306861 predicted 339
9 SASI_Mm02_00306862 predicted 189
10 SASI_Mm02_00306863 predicted 99
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001165877
ATP5L2 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-625s21c1
Sequence:CCGGGGCTAGAATGTTTGAAGACCACTCGAGTGGTCTTCAAACATTCTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-540s21c1
Sequence:CCGGGGAAGCTTTGCTGAACGGTTTCTCGAGAAACCGTTCAGCAAAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-587s21c1
Sequence:CCGGTTTATGTCAGAGAGATCACAGCTCGAGCTGTGATCTCTCTGACATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-520s21c1
Sequence:CCGGTTCAAACAGCTCACAGTTAAGCTCGAGCTTAACTGTGAGCTGTTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-600s21c1
Sequence:CCGGGATCACAGGCAAGCGTGGCATCTCGAGATGCCACGCTTGCCTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-568s21c1
Sequence:CCGGACTGAGGTGTCGACGTGGTTTCTCGAGAAACCACGTCGACACCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-612s21c1
Sequence:CCGGGCGTGGCATCATTGGCTAGAACTCGAGTTCTAGCCAATGATGCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-388s21c1
Sequence:CCGGACTTACTTGAAGCCTCGATTGCTCGAGCAATCGAGGCTTCAAGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-552s21c1
Sequence:CCGGGAACGGTTTGGTGGCCACTGACTCGAGTCAGTGGCCACCAAACCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001165877.1-697s21c1
Sequence:CCGGGTGTGATCAGACTGCTATCTGCTCGAGCAGATAGCAGTCTGATCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001165877
ATP5L2 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-625s21c1
Sequence:CCGGGGCTAGAATGTTTGAAGACCACTCGAGTGGTCTTCAAACATTCTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-540s21c1
Sequence:CCGGGGAAGCTTTGCTGAACGGTTTCTCGAGAAACCGTTCAGCAAAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-587s21c1
Sequence:CCGGTTTATGTCAGAGAGATCACAGCTCGAGCTGTGATCTCTCTGACATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-520s21c1
Sequence:CCGGTTCAAACAGCTCACAGTTAAGCTCGAGCTTAACTGTGAGCTGTTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-600s21c1
Sequence:CCGGGATCACAGGCAAGCGTGGCATCTCGAGATGCCACGCTTGCCTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-568s21c1
Sequence:CCGGACTGAGGTGTCGACGTGGTTTCTCGAGAAACCACGTCGACACCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-612s21c1
Sequence:CCGGGCGTGGCATCATTGGCTAGAACTCGAGTTCTAGCCAATGATGCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-388s21c1
Sequence:CCGGACTTACTTGAAGCCTCGATTGCTCGAGCAATCGAGGCTTCAAGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-552s21c1
Sequence:CCGGGAACGGTTTGGTGGCCACTGACTCGAGTCAGTGGCCACCAAACCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001165877.1-697s21c1
Sequence:CCGGGTGTGATCAGACTGCTATCTGCTCGAGCAGATAGCAGTCTGATCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001165877
ATP5L2 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435140    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-625s21c1
Sequence:CCGGGGCTAGAATGTTTGAAGACCACTCGAGTGGTCTTCAAACATTCTAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-540s21c1
Sequence:CCGGGGAAGCTTTGCTGAACGGTTTCTCGAGAAACCGTTCAGCAAAGCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413594    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-587s21c1
Sequence:CCGGTTTATGTCAGAGAGATCACAGCTCGAGCTGTGATCTCTCTGACATAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-520s21c1
Sequence:CCGGTTCAAACAGCTCACAGTTAAGCTCGAGCTTAACTGTGAGCTGTTTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415913    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-600s21c1
Sequence:CCGGGATCACAGGCAAGCGTGGCATCTCGAGATGCCACGCTTGCCTGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-568s21c1
Sequence:CCGGACTGAGGTGTCGACGTGGTTTCTCGAGAAACCACGTCGACACCTCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-612s21c1
Sequence:CCGGGCGTGGCATCATTGGCTAGAACTCGAGTTCTAGCCAATGATGCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425389    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-388s21c1
Sequence:CCGGACTTACTTGAAGCCTCGATTGCTCGAGCAATCGAGGCTTCAAGTAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001165877.1-552s21c1
Sequence:CCGGGAACGGTTTGGTGGCCACTGACTCGAGTCAGTGGCCACCAAACCGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428044    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001165877.1-697s21c1
Sequence:CCGGGTGTGATCAGACTGCTATCTGCTCGAGCAGATAGCAGTCTGATCACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001111335
VALIDATED
ATP5L2 MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000262705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001111335.1-142s21c1
Sequence:CCGGCTGAAATCCCTACAGCTATTCCTCGAGGAATAGCTGTAGGGATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111335.1-203s21c1
Sequence:CCGGCTTCAAACACCTTAGAGTTAACTCGAGTTAACTCTAAGGTGTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111335.1-102s21c1
Sequence:CCGGTGGCACTACACCAAGGTTGAGCTCGAGCTCAACCTTGGTGTAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001111335.1-225s21c1
Sequence:CCGGGAAGCTGTGCTGAATGGTTTGCTCGAGCAAACCATTCAGCACAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001111335.1-72s21c1
Sequence:CCGGACTTACTCGAAGCCTCGATTGCTCGAGCAATCGAGGCTTCGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001111335
VALIDATED
ATP5L2 MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000262705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001111335.1-142s21c1
Sequence:CCGGCTGAAATCCCTACAGCTATTCCTCGAGGAATAGCTGTAGGGATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111335.1-203s21c1
Sequence:CCGGCTTCAAACACCTTAGAGTTAACTCGAGTTAACTCTAAGGTGTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111335.1-102s21c1
Sequence:CCGGTGGCACTACACCAAGGTTGAGCTCGAGCTCAACCTTGGTGTAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001111335.1-225s21c1
Sequence:CCGGGAAGCTGTGCTGAATGGTTTGCTCGAGCAAACCATTCAGCACAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001111335.1-72s21c1
Sequence:CCGGACTTACTCGAAGCCTCGATTGCTCGAGCAATCGAGGCTTCGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001111335
VALIDATED
ATP5L2 MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000262705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001111335.1-142s21c1
Sequence:CCGGCTGAAATCCCTACAGCTATTCCTCGAGGAATAGCTGTAGGGATTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262703    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111335.1-203s21c1
Sequence:CCGGCTTCAAACACCTTAGAGTTAACTCGAGTTAACTCTAAGGTGTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001111335.1-102s21c1
Sequence:CCGGTGGCACTACACCAAGGTTGAGCTCGAGCTCAACCTTGGTGTAGTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001111335.1-225s21c1
Sequence:CCGGGAAGCTGTGCTGAATGGTTTGCTCGAGCAAACCATTCAGCACAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257125    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001111335.1-72s21c1
Sequence:CCGGACTTACTCGAAGCCTCGATTGCTCGAGCAATCGAGGCTTCGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks