EMAIL THIS PAGE TO A FRIEND

ATP5L

ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G

59 Gene Product Result for
Synonyms: ATP5JG
UniProtKB ID: O75964, A8K0K3, Q96BV6, Q9UBZ7
Gene ID:
Human(10632) Summary: Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. It is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, which comprises the proton channel. The F1 complex consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled in a ratio of 3 alpha, 3 beta, and a single representative of the other 3. The Fo seems to have nine subunits (a, b, c, d, e, f, g, F6 and 8). This gene encodes the g subunit of the Fo complex. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jun 2010]
Mouse(27425) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit g
Rat(300677) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
naked mole-rat(101713385) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
domestic guinea pig(100725935) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
sheep(101123491) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
Zebrafish(326977) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit g
cow(515696) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
domestic cat(101090042) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
chicken(770052) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
chicken(101749042) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
chicken(101667846) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013795 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013795 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013795 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006476 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006476 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006476 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006476 Rosetta Predictions human pricing
NM_212516 Rosetta Predictions rat pricing
NM_013795 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006476 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097438 predicted 706
2 SASI_Hs01_00097439 predicted 714
3 SASI_Hs01_00097441 predicted 564
4 SASI_Hs02_00341657 predicted 764
5 SASI_Hs02_00341658 predicted 574
6 SASI_Hs01_00097442 predicted 579
7 SASI_Hs01_00097444 predicted 592
8 SASI_Hs02_00341659 predicted 764
9 SASI_Hs01_00097446 predicted 363
10 SASI_Hs01_00097447 predicted 805
11 SASI_Hs01_00097440 predicted 636
12 SASI_Hs01_00097443 predicted 487
13 SASI_Hs01_00097445 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00093699 predicted 198
2 SASI_Rn01_00093700 predicted 208
3 SASI_Rn01_00093702 predicted 200
4 SASI_Rn01_00093703 predicted 200
5 SASI_Rn01_00093704 predicted 198
6 SASI_Rn01_00093705 predicted 224
7 SASI_Rn01_00093707 predicted 199
8 SASI_Rn01_00093708 predicted 224
9 SASI_Rn02_00270528 predicted 232
10 SASI_Rn02_00270529 predicted 231
11 SASI_Rn01_00093701 predicted 205
12 SASI_Rn01_00093706 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013795 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113968 predicted 234
2 SASI_Mm01_00113969 predicted 236
3 SASI_Mm02_00322750 predicted 383
4 SASI_Mm01_00113970 predicted 358
5 SASI_Mm01_00113971 predicted 254
6 SASI_Mm01_00113972 predicted 191
7 SASI_Mm01_00113973 predicted 334
8 SASI_Mm01_00113974 predicted 140
9 SASI_Mm02_00322751 predicted 380
10 SASI_Mm01_00113975 predicted 104
11 SASI_Mm01_00113976 predicted 269
12 SASI_Mm01_00113977 predicted 271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013795
VALIDATED
ATP5L MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.5-282s21c1
Sequence:CCGGCCTTACAGTTAAGGAAGCTGTCTCGAGACAGCTTCCTTAACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-245s21c1
Sequence:CCGGGCTTCAAACACCTTACAGTTACTCGAGTAACTGTAAGGTGTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-359s21c1
Sequence:CCGGATGTTTGAAGACCAATCTTTACTCGAGTAAAGATTGGTCTTCAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013795.4-105s1c2
Sequence:CCGGCGCTGCCGTGACTTACTCGAACTCGAGTTCGAGTAAGTCACGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-196s21c1
Sequence:CCGGACAGCTATTCAGAGTGTGAAACTCGAGTTTCACACTCTGAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-295s21c1
Sequence:CCGGACTGAGGTGTGGATGTGGTTTCTCGAGAAACCACATCCACACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-105s21c1
Sequence:CCGGCGCTGCCGTGACTTACTCGAACTCGAGTTCGAGTAAGTCACGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013795.4-245s1c1
Sequence:CCGGGCTTCAAACACCTTACAGTTACTCGAGTAACTGTAAGGTGTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013795.4-182s1c1
Sequence:CCGGCTGCTGAAATCCCTACAGCTACTCGAGTAGCTGTAGGGATTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013795.4-255s1c1
Sequence:CCGGCCTTACAGTTAAGGAAGCTGTCTCGAGACAGCTTCCTTAACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013795.4-196s1c1
Sequence:CCGGACAGCTATTCAGAGTGTGAAACTCGAGTTTCACACTCTGAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013795
VALIDATED
ATP5L MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.5-282s21c1
Sequence:CCGGCCTTACAGTTAAGGAAGCTGTCTCGAGACAGCTTCCTTAACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-245s21c1
Sequence:CCGGGCTTCAAACACCTTACAGTTACTCGAGTAACTGTAAGGTGTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-359s21c1
Sequence:CCGGATGTTTGAAGACCAATCTTTACTCGAGTAAAGATTGGTCTTCAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013795.4-105s1c2
Sequence:CCGGCGCTGCCGTGACTTACTCGAACTCGAGTTCGAGTAAGTCACGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-196s21c1
Sequence:CCGGACAGCTATTCAGAGTGTGAAACTCGAGTTTCACACTCTGAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-295s21c1
Sequence:CCGGACTGAGGTGTGGATGTGGTTTCTCGAGAAACCACATCCACACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-105s21c1
Sequence:CCGGCGCTGCCGTGACTTACTCGAACTCGAGTTCGAGTAAGTCACGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013795.4-245s1c1
Sequence:CCGGGCTTCAAACACCTTACAGTTACTCGAGTAACTGTAAGGTGTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013795.4-182s1c1
Sequence:CCGGCTGCTGAAATCCCTACAGCTACTCGAGTAGCTGTAGGGATTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013795.4-255s1c1
Sequence:CCGGCCTTACAGTTAAGGAAGCTGTCTCGAGACAGCTTCCTTAACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013795.4-196s1c1
Sequence:CCGGACAGCTATTCAGAGTGTGAAACTCGAGTTTCACACTCTGAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013795
VALIDATED
ATP5L MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334390    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.5-282s21c1
Sequence:CCGGCCTTACAGTTAAGGAAGCTGTCTCGAGACAGCTTCCTTAACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325553    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-245s21c1
Sequence:CCGGGCTTCAAACACCTTACAGTTACTCGAGTAACTGTAAGGTGTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-359s21c1
Sequence:CCGGATGTTTGAAGACCAATCTTTACTCGAGTAAAGATTGGTCTTCAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013795.4-105s1c2
Sequence:CCGGCGCTGCCGTGACTTACTCGAACTCGAGTTCGAGTAAGTCACGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325555    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-196s21c1
Sequence:CCGGACAGCTATTCAGAGTGTGAAACTCGAGTTTCACACTCTGAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-295s21c1
Sequence:CCGGACTGAGGTGTGGATGTGGTTTCTCGAGAAACCACATCCACACCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013795.4-105s21c1
Sequence:CCGGCGCTGCCGTGACTTACTCGAACTCGAGTTCGAGTAAGTCACGGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013795.4-245s1c1
Sequence:CCGGGCTTCAAACACCTTACAGTTACTCGAGTAACTGTAAGGTGTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013795.4-182s1c1
Sequence:CCGGCTGCTGAAATCCCTACAGCTACTCGAGTAGCTGTAGGGATTTCAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013795.4-255s1c1
Sequence:CCGGCCTTACAGTTAAGGAAGCTGTCTCGAGACAGCTTCCTTAACTGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013795.4-196s1c1
Sequence:CCGGACAGCTATTCAGAGTGTGAAACTCGAGTTTCACACTCTGAATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006476
VALIDATED
ATP5L MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006476.4-469s21c1
Sequence:CCGGCTTCAAACAGCTCACAGTTAACTCGAGTTAACTGTGAGCTGTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006476.4-803s21c1
Sequence:CCGGAGGATATATGTGGCAATATTACTCGAGTAATATTGCCACATATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006476.4-538s21c1
Sequence:GTACCGGTTATGTCGGAGAGATTATAGGCTCGAGCCTATAATCTCTCCGACATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006476.4-582s21c1
Sequence:CCGGATGTTTGAAGACCAATCTTTACTCGAGTAAAGATTGGTCTTCAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006476.4-338s21c1
Sequence:CCGGACTTACTCGAAGCCTCGATTGCTCGAGCAATCGAGGCTTCGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-329s1c1
Sequence:CCGGTGTCGGAGAGATTATAGGCAACTCGAGTTGCCTATAATCTCTCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-256s1c1
Sequence:CCGGGCTTCAAACAGCTCACAGTTACTCGAGTAACTGTGAGCTGTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-235s1c1
Sequence:CCGGCCAATAGTGCTCAGACTGGTACTCGAGTACCAGTCTGAGCACTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-125s1c1
Sequence:CCGGGACTTACTCGAAGCCTCGATTCTCGAGAATCGAGGCTTCGAGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-207s1c1
Sequence:CCGGAGAGCTATTCAGAGCCTGAAACTCGAGTTTCAGGCTCTGAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006476
VALIDATED
ATP5L MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006476.4-469s21c1
Sequence:CCGGCTTCAAACAGCTCACAGTTAACTCGAGTTAACTGTGAGCTGTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006476.4-803s21c1
Sequence:CCGGAGGATATATGTGGCAATATTACTCGAGTAATATTGCCACATATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006476.4-538s21c1
Sequence:GTACCGGTTATGTCGGAGAGATTATAGGCTCGAGCCTATAATCTCTCCGACATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006476.4-582s21c1
Sequence:CCGGATGTTTGAAGACCAATCTTTACTCGAGTAAAGATTGGTCTTCAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006476.4-338s21c1
Sequence:CCGGACTTACTCGAAGCCTCGATTGCTCGAGCAATCGAGGCTTCGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-329s1c1
Sequence:CCGGTGTCGGAGAGATTATAGGCAACTCGAGTTGCCTATAATCTCTCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-256s1c1
Sequence:CCGGGCTTCAAACAGCTCACAGTTACTCGAGTAACTGTGAGCTGTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-235s1c1
Sequence:CCGGCCAATAGTGCTCAGACTGGTACTCGAGTACCAGTCTGAGCACTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-125s1c1
Sequence:CCGGGACTTACTCGAAGCCTCGATTCTCGAGAATCGAGGCTTCGAGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-207s1c1
Sequence:CCGGAGAGCTATTCAGAGCCTGAAACTCGAGTTTCAGGCTCTGAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006476
VALIDATED
ATP5L MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit G
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006476.4-469s21c1
Sequence:CCGGCTTCAAACAGCTCACAGTTAACTCGAGTTAACTGTGAGCTGTTTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230011    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006476.4-803s21c1
Sequence:CCGGAGGATATATGTGGCAATATTACTCGAGTAATATTGCCACATATATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_006476.4-538s21c1
Sequence:GTACCGGTTATGTCGGAGAGATTATAGGCTCGAGCCTATAATCTCTCCGACATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006476.4-582s21c1
Sequence:CCGGATGTTTGAAGACCAATCTTTACTCGAGTAAAGATTGGTCTTCAAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006476.4-338s21c1
Sequence:CCGGACTTACTCGAAGCCTCGATTGCTCGAGCAATCGAGGCTTCGAGTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-329s1c1
Sequence:CCGGTGTCGGAGAGATTATAGGCAACTCGAGTTGCCTATAATCTCTCCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-256s1c1
Sequence:CCGGGCTTCAAACAGCTCACAGTTACTCGAGTAACTGTGAGCTGTTTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-235s1c1
Sequence:CCGGCCAATAGTGCTCAGACTGGTACTCGAGTACCAGTCTGAGCACTATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-125s1c1
Sequence:CCGGGACTTACTCGAAGCCTCGATTCTCGAGAATCGAGGCTTCGAGTAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006476.3-207s1c1
Sequence:CCGGAGAGCTATTCAGAGCCTGAAACTCGAGTTTCAGGCTCTGAATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks