EMAIL THIS PAGE TO A FRIEND

ATP5O

ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit

46 Gene Product Result for
Synonyms: ATPO OSCP
UniProtKB ID: P48047, B2R4E2, Q5U042, Q6IBI2
Gene ID:
Human(539) Summary: The protein encoded by this gene is a component of the F-type ATPase found in the mitochondrial matrix. F-type ATPases are composed of a catalytic core and a membrane proton channel. The encoded protein appears to be part of the connector linking these two components and may be involved in transmission of conformational changes or proton conductance. [provided by RefSeq, Jul 2008]
Mouse(28080) ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Rat(192241) ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Zebrafish(335191) ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
dog(478410) ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
chicken(418508) ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
cow(281640) ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
domestic cat(101087259) ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
naked mole-rat(101700501) ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
domestic guinea pig(100726068) ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
sheep(100305130) ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Domestic Rabbit(100328815) ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001697 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001697 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001697 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001697 Rosetta Predictions human pricing
NM_138883 Rosetta Predictions rat pricing
NM_138597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113855 predicted 326
2 SASI_Hs01_00113856 predicted 537
3 SASI_Hs02_00332364 predicted 272
4 SASI_Hs01_00113857 predicted 498
5 SASI_Hs01_00113858 predicted 202
6 SASI_Hs01_00113859 predicted 400
7 SASI_Hs01_00113860 predicted 244
8 SASI_Hs01_00113861 predicted 203
9 SASI_Hs01_00113862 predicted 209
10 SASI_Hs01_00113863 predicted 395
11 SASI_Hs01_00113864 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138883 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048884 predicted 453
2 SASI_Rn01_00048885 predicted 462
3 SASI_Rn02_00268316 predicted 430
4 SASI_Rn01_00048887 predicted 218
5 SASI_Rn01_00048888 predicted 316
6 SASI_Rn01_00048889 predicted 269
7 SASI_Rn01_00048890 predicted 240
8 SASI_Rn01_00048891 predicted 484
9 SASI_Rn01_00048892 predicted 321
10 SASI_Rn01_00048893 predicted 311
11 SASI_Rn01_00048886 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071219 predicted 470
2 SASI_Mm01_00071218 predicted 478
3 SASI_Mm01_00071220 predicted 486
4 SASI_Mm01_00071221 predicted 474
5 SASI_Mm01_00071222 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001697
VALIDATED
ATP5O MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001697.2-583s21c1
Sequence:CCGGCCTAAGTCAAGGCCAAGTATTCTCGAGAATACTTGGCCTTGACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001697.2-400s21c1
Sequence:CCGGCCTCACTACCAATCTGATCAACTCGAGTTGATCAGATTGGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001697.2-332s21c1
Sequence:CCGGCCCTATGTGAAGCGTTCCATTCTCGAGAATGGAACGCTTCACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001697.2-210s21c1
Sequence:CCGGGCTATGCCACAGCTCTTTATTCTCGAGAATAAAGAGCTGTGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001697.2-625s21c1
Sequence:CCGGTCCGTCAATCTTGGGTGGAATCTCGAGATTCCACCCAAGATTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-210s1c1
Sequence:CCGGGCTATGCCACAGCTCTTTATTCTCGAGAATAAAGAGCTGTGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-332s1c1
Sequence:CCGGCCCTATGTGAAGCGTTCCATTCTCGAGAATGGAACGCTTCACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-625s1c1
Sequence:CCGGTCCGTCAATCTTGGGTGGAATCTCGAGATTCCACCCAAGATTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-400s1c1
Sequence:CCGGCCTCACTACCAATCTGATCAACTCGAGTTGATCAGATTGGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-583s1c1
Sequence:CCGGCCTAAGTCAAGGCCAAGTATTCTCGAGAATACTTGGCCTTGACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001697
VALIDATED
ATP5O MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001697.2-583s21c1
Sequence:CCGGCCTAAGTCAAGGCCAAGTATTCTCGAGAATACTTGGCCTTGACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001697.2-400s21c1
Sequence:CCGGCCTCACTACCAATCTGATCAACTCGAGTTGATCAGATTGGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001697.2-332s21c1
Sequence:CCGGCCCTATGTGAAGCGTTCCATTCTCGAGAATGGAACGCTTCACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001697.2-210s21c1
Sequence:CCGGGCTATGCCACAGCTCTTTATTCTCGAGAATAAAGAGCTGTGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001697.2-625s21c1
Sequence:CCGGTCCGTCAATCTTGGGTGGAATCTCGAGATTCCACCCAAGATTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-210s1c1
Sequence:CCGGGCTATGCCACAGCTCTTTATTCTCGAGAATAAAGAGCTGTGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-332s1c1
Sequence:CCGGCCCTATGTGAAGCGTTCCATTCTCGAGAATGGAACGCTTCACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-625s1c1
Sequence:CCGGTCCGTCAATCTTGGGTGGAATCTCGAGATTCCACCCAAGATTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-400s1c1
Sequence:CCGGCCTCACTACCAATCTGATCAACTCGAGTTGATCAGATTGGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-583s1c1
Sequence:CCGGCCTAAGTCAAGGCCAAGTATTCTCGAGAATACTTGGCCTTGACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001697
VALIDATED
ATP5O MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001697.2-583s21c1
Sequence:CCGGCCTAAGTCAAGGCCAAGTATTCTCGAGAATACTTGGCCTTGACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001697.2-400s21c1
Sequence:CCGGCCTCACTACCAATCTGATCAACTCGAGTTGATCAGATTGGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001697.2-332s21c1
Sequence:CCGGCCCTATGTGAAGCGTTCCATTCTCGAGAATGGAACGCTTCACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_001697.2-210s21c1
Sequence:CCGGGCTATGCCACAGCTCTTTATTCTCGAGAATAAAGAGCTGTGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_001697.2-625s21c1
Sequence:CCGGTCCGTCAATCTTGGGTGGAATCTCGAGATTCCACCCAAGATTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-210s1c1
Sequence:CCGGGCTATGCCACAGCTCTTTATTCTCGAGAATAAAGAGCTGTGGCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-332s1c1
Sequence:CCGGCCCTATGTGAAGCGTTCCATTCTCGAGAATGGAACGCTTCACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-625s1c1
Sequence:CCGGTCCGTCAATCTTGGGTGGAATCTCGAGATTCCACCCAAGATTGACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-400s1c1
Sequence:CCGGCCTCACTACCAATCTGATCAACTCGAGTTGATCAGATTGGTAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001697.2-583s1c1
Sequence:CCGGCCTAAGTCAAGGCCAAGTATTCTCGAGAATACTTGGCCTTGACTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138597
VALIDATED
ATP5O MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-305s1c1
Sequence:CCGGTGTTCTGAATCCCTACATCAACTCGAGTTGATGTAGGGATTCAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-205s1c1
Sequence:CCGGCCCTGTACTCTGCTGCATCTACTCGAGTAGATGCAGCAGAGTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-562s1c1
Sequence:CCGGGCTTCCTGAGTCCAAACCAAACTCGAGTTTGGTTTGGACTCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-569s1c1
Sequence:CCGGGAGTCCAAACCAAATACTGAACTCGAGTTCAGTATTTGGTTTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-126s1c1
Sequence:CCGGACATCTGTGGTCAGGCCCTTTCTCGAGAAAGGGCCTGACCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138597
VALIDATED
ATP5O MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-305s1c1
Sequence:CCGGTGTTCTGAATCCCTACATCAACTCGAGTTGATGTAGGGATTCAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-205s1c1
Sequence:CCGGCCCTGTACTCTGCTGCATCTACTCGAGTAGATGCAGCAGAGTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-562s1c1
Sequence:CCGGGCTTCCTGAGTCCAAACCAAACTCGAGTTTGGTTTGGACTCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-569s1c1
Sequence:CCGGGAGTCCAAACCAAATACTGAACTCGAGTTCAGTATTTGGTTTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-126s1c1
Sequence:CCGGACATCTGTGGTCAGGCCCTTTCTCGAGAAAGGGCCTGACCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138597
VALIDATED
ATP5O MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial F1 complex, O subunit
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076164    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-305s1c1
Sequence:CCGGTGTTCTGAATCCCTACATCAACTCGAGTTGATGTAGGGATTCAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076163    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-205s1c1
Sequence:CCGGCCCTGTACTCTGCTGCATCTACTCGAGTAGATGCAGCAGAGTACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-562s1c1
Sequence:CCGGGCTTCCTGAGTCCAAACCAAACTCGAGTTTGGTTTGGACTCAGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076167    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-569s1c1
Sequence:CCGGGAGTCCAAACCAAATACTGAACTCGAGTTCAGTATTTGGTTTGGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_138597.1-126s1c1
Sequence:CCGGACATCTGTGGTCAGGCCCTTTCTCGAGAAAGGGCCTGACCACAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks