EMAIL THIS PAGE TO A FRIEND

ATP5S

ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)

89 Gene Product Result for
Synonyms: ATPW FB HSU79253
UniProtKB ID: Q99766, A8K1U3, D9N156, Q8WWX3, Q96F77
Gene ID:
Human(27109) Summary: This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. This gene encodes the subunit s, also known as factor B, of the proton channel. This subunit is necessary for the energy transduction activity of the ATP synthase complexes. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(68055) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s
Rat(362749) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
sheep(101103572) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
domestic guinea pig(100727227) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
naked mole-rat(101698657) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
Zebrafish(393187) ATP synthase, H+ transporting, mitochondrial F0 complex, subunit s
chicken(423574) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
domestic cat(101095021) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
cow(493709) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
dog(490683) ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026536 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026536 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026536 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015684 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015684 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015684 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003803 Rosetta Predictions human pricing
NM_001003805 Rosetta Predictions human pricing
NM_015684 Rosetta Predictions human pricing
NM_001007749 Rosetta Predictions rat pricing
NM_026536 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174169 predicted 1373
2 SASI_Hs01_00174172 predicted 1222
3 SASI_Hs01_00174173 predicted 1412
4 SASI_Hs01_00174174 predicted 1100
5 SASI_Hs01_00174175 predicted 1385
6 SASI_Hs01_00174176 predicted 1195
7 SASI_Hs01_00174177 predicted 1380
8 SASI_Hs01_00174178 predicted 1234
9 SASI_Hs02_00304393 predicted 1205
10 SASI_Hs01_00174171 predicted 829
11 SASI_Hs01_00174170 predicted 1206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003805 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070804 predicted 1200
2 SASI_Hs01_00070805 predicted 781
3 SASI_Hs01_00070806 predicted 783
4 SASI_Hs02_00304394 predicted 1074
5 SASI_Hs01_00070807 predicted 712
6 SASI_Hs01_00070808 predicted 1047
7 SASI_Hs01_00070810 predicted 1102
8 SASI_Hs01_00070811 predicted 1232
9 SASI_Hs01_00070812 predicted 1040
10 SASI_Hs02_00304395 predicted 1215
11 SASI_Hs01_00070803 predicted 968
12 SASI_Hs01_00070809 predicted 1343
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015684 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104488 predicted 783
2 SASI_Hs01_00104489 predicted 786
3 SASI_Hs01_00104490 predicted 710
4 SASI_Hs01_00104491 predicted 1044
5 SASI_Hs01_00104494 predicted 1079
6 SASI_Hs01_00104495 predicted 1274
7 SASI_Hs01_00104496 predicted 1319
8 SASI_Hs02_00348334 predicted 1253
9 SASI_Hs02_00348335 predicted 1312
10 SASI_Hs02_00348336 predicted 1300
11 SASI_Hs01_00104487 predicted 966
12 SASI_Hs01_00104492 predicted 836
13 SASI_Hs01_00104493 predicted 1272
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109480 predicted 960
2 SASI_Rn01_00109481 predicted 404
3 SASI_Rn01_00109482 predicted 563
4 SASI_Rn01_00109483 predicted 951
5 SASI_Rn01_00109484 predicted 945
6 SASI_Rn01_00109485 predicted 941
7 SASI_Rn01_00109486 predicted 969
8 SASI_Rn01_00109488 predicted 607
9 SASI_Rn01_00109489 predicted 559
10 SASI_Rn02_00198943 predicted 811
11 SASI_Rn01_00109487 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026536 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182811 predicted 299
2 SASI_Mm01_00182812 predicted 291
3 SASI_Mm01_00182813 predicted 288
4 SASI_Mm01_00182815 predicted 328
5 SASI_Mm01_00182816 predicted 274
6 SASI_Mm01_00182817 predicted 347
7 SASI_Mm01_00182819 predicted 558
8 SASI_Mm01_00182820 predicted 257
9 SASI_Mm02_00330464 predicted 560
10 SASI_Mm02_00330465 predicted 531
11 SASI_Mm01_00182814 predicted 1138
12 SASI_Mm01_00182818 predicted 310
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026536
ATP5S MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026536.1-1327s1c1
Sequence:CCGGCCCATCTGCTTCAAACAAGAACTCGAGTTCTTGTTTGAAGCAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026536.1-114s1c1
Sequence:CCGGGTCATGTGACTCCAGATACTTCTCGAGAAGTATCTGGAGTCACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026536.1-473s1c1
Sequence:CCGGGCCTATTGGAACTGGAAATAACTCGAGTTATTTCCAGTTCCAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026536.1-589s1c1
Sequence:CCGGGATAAAGAATACCTTGCCCAACTCGAGTTGGGCAAGGTATTCTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026536.1-522s21c1
Sequence:CCGGCGTCATTGCTCTGCGACATTTCTCGAGAAATGTCGCAGAGCAATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026536.1-336s1c2
Sequence:CCGGCGATTCTTGTATCATGGACATCTCGAGATGTCCATGATACAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026536.1-665s21c1
Sequence:CCGGAGTGTCTGGTGTCACTATTAACTCGAGTTAATAGTGACACCAGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026536.1-402s21c1
Sequence:CCGGACTATGCAAGTGTCATTATATCTCGAGATATAATGACACTTGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026536.1-703s21c1
Sequence:CCGGTGATACTAGACAGCTACAAATCTCGAGATTTGTAGCTGTCTAGTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026536
ATP5S MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026536.1-1327s1c1
Sequence:CCGGCCCATCTGCTTCAAACAAGAACTCGAGTTCTTGTTTGAAGCAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026536.1-114s1c1
Sequence:CCGGGTCATGTGACTCCAGATACTTCTCGAGAAGTATCTGGAGTCACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026536.1-473s1c1
Sequence:CCGGGCCTATTGGAACTGGAAATAACTCGAGTTATTTCCAGTTCCAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026536.1-589s1c1
Sequence:CCGGGATAAAGAATACCTTGCCCAACTCGAGTTGGGCAAGGTATTCTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026536.1-522s21c1
Sequence:CCGGCGTCATTGCTCTGCGACATTTCTCGAGAAATGTCGCAGAGCAATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026536.1-336s1c2
Sequence:CCGGCGATTCTTGTATCATGGACATCTCGAGATGTCCATGATACAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026536.1-665s21c1
Sequence:CCGGAGTGTCTGGTGTCACTATTAACTCGAGTTAATAGTGACACCAGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026536.1-402s21c1
Sequence:CCGGACTATGCAAGTGTCATTATATCTCGAGATATAATGACACTTGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026536.1-703s21c1
Sequence:CCGGTGATACTAGACAGCTACAAATCTCGAGATTTGTAGCTGTCTAGTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026536
ATP5S MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026536.1-1327s1c1
Sequence:CCGGCCCATCTGCTTCAAACAAGAACTCGAGTTCTTGTTTGAAGCAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026536.1-114s1c1
Sequence:CCGGGTCATGTGACTCCAGATACTTCTCGAGAAGTATCTGGAGTCACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026536.1-473s1c1
Sequence:CCGGGCCTATTGGAACTGGAAATAACTCGAGTTATTTCCAGTTCCAATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026536.1-589s1c1
Sequence:CCGGGATAAAGAATACCTTGCCCAACTCGAGTTGGGCAAGGTATTCTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447371    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026536.1-522s21c1
Sequence:CCGGCGTCATTGCTCTGCGACATTTCTCGAGAAATGTCGCAGAGCAATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026536.1-336s1c2
Sequence:CCGGCGATTCTTGTATCATGGACATCTCGAGATGTCCATGATACAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026536.1-665s21c1
Sequence:CCGGAGTGTCTGGTGTCACTATTAACTCGAGTTAATAGTGACACCAGACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026536.1-402s21c1
Sequence:CCGGACTATGCAAGTGTCATTATATCTCGAGATATAATGACACTTGCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026536.1-703s21c1
Sequence:CCGGTGATACTAGACAGCTACAAATCTCGAGATTTGTAGCTGTCTAGTATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015684
VALIDATED
ATP5S MISSION shRNA Bacterial Glycerol Stock
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015684.1-715s1c1
Sequence:CCGGGCAGTTGTGTGGCGTAAAGAACTCGAGTTCTTTACGCCACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015684.1-680s1c1
Sequence:CCGGGCAGATCAAATGATGCTGTTTCTCGAGAAACAGCATCATTTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015684.1-928s1c1
Sequence:CCGGCCCTCTGGACAAATACAAGATCTCGAGATCTTGTATTTGTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015684.1-967s1c1
Sequence:CCGGCGACTCTTGTATCATGAGCATCTCGAGATGCTCATGATACAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015684.1-771s1c1
Sequence:CCGGGCTGGTTGAATGCAGTGTTTACTCGAGTAAACACTGCATTCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015684.2-1089s21c1
Sequence:GTACCGGGATGATTTGCAGTGACCATTTCTCGAGAAATGGTCACTGCAAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015684.2-1113s21c1
Sequence:CCGGTGCAGTTGACTCACGATTATACTCGAGTATAATCGTGAGTCAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015684.2-835s21c1
Sequence:CCGGTGTTTAATAAGGTGGATTATGCTCGAGCATAATCCACCTTATTAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015684.2-761s21c1
Sequence:CCGGCCAGCAGTTGTGTGGCGTAAACTCGAGTTTACGCCACACAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015684.2-719s21c1
Sequence:CCGGACTCACCTGTGCAGATCAAATCTCGAGATTTGATCTGCACAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015684
VALIDATED
ATP5S MISSION shRNA shRNA Plasmid DNA
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015684.1-715s1c1
Sequence:CCGGGCAGTTGTGTGGCGTAAAGAACTCGAGTTCTTTACGCCACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015684.1-680s1c1
Sequence:CCGGGCAGATCAAATGATGCTGTTTCTCGAGAAACAGCATCATTTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015684.1-928s1c1
Sequence:CCGGCCCTCTGGACAAATACAAGATCTCGAGATCTTGTATTTGTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015684.1-967s1c1
Sequence:CCGGCGACTCTTGTATCATGAGCATCTCGAGATGCTCATGATACAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015684.1-771s1c1
Sequence:CCGGGCTGGTTGAATGCAGTGTTTACTCGAGTAAACACTGCATTCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015684.2-1089s21c1
Sequence:GTACCGGGATGATTTGCAGTGACCATTTCTCGAGAAATGGTCACTGCAAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015684.2-1113s21c1
Sequence:CCGGTGCAGTTGACTCACGATTATACTCGAGTATAATCGTGAGTCAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015684.2-835s21c1
Sequence:CCGGTGTTTAATAAGGTGGATTATGCTCGAGCATAATCCACCTTATTAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015684.2-761s21c1
Sequence:CCGGCCAGCAGTTGTGTGGCGTAAACTCGAGTTTACGCCACACAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015684.2-719s21c1
Sequence:CCGGACTCACCTGTGCAGATCAAATCTCGAGATTTGATCTGCACAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015684
VALIDATED
ATP5S MISSION shRNA Lentiviral Transduction Particles
ATP synthase, H+ transporting, mitochondrial Fo complex, subunit s (factor B)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038418    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015684.1-715s1c1
Sequence:CCGGGCAGTTGTGTGGCGTAAAGAACTCGAGTTCTTTACGCCACACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015684.1-680s1c1
Sequence:CCGGGCAGATCAAATGATGCTGTTTCTCGAGAAACAGCATCATTTGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015684.1-928s1c1
Sequence:CCGGCCCTCTGGACAAATACAAGATCTCGAGATCTTGTATTTGTCCAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038417    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015684.1-967s1c1
Sequence:CCGGCGACTCTTGTATCATGAGCATCTCGAGATGCTCATGATACAAGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015684.1-771s1c1
Sequence:CCGGGCTGGTTGAATGCAGTGTTTACTCGAGTAAACACTGCATTCAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015684.2-1089s21c1
Sequence:GTACCGGGATGATTTGCAGTGACCATTTCTCGAGAAATGGTCACTGCAAATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230133    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015684.2-1113s21c1
Sequence:CCGGTGCAGTTGACTCACGATTATACTCGAGTATAATCGTGAGTCAACTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015684.2-835s21c1
Sequence:CCGGTGTTTAATAAGGTGGATTATGCTCGAGCATAATCCACCTTATTAAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015684.2-761s21c1
Sequence:CCGGCCAGCAGTTGTGTGGCGTAAACTCGAGTTTACGCCACACAACTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015684.2-719s21c1
Sequence:CCGGACTCACCTGTGCAGATCAAATCTCGAGATTTGATCTGCACAGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks