EMAIL THIS PAGE TO A FRIEND

ATP5SL

ATP5S-like

49 Gene Product Result for
Gene ID:
Mouse(66349) ATP5S-like
Rat(361520) ATP5S-like
cow(530597) ATP5S-like
dog(484486) ATP5S-like
sheep(101122972) ATP5S-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041427 Anti-ATP5SL antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025504 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025504 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025504 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018035 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018035 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018035 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018035 Rosetta Predictions human pricing
NM_001009705 Rosetta Predictions rat pricing
NM_025504 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018035 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067855 predicted 318
2 SASI_Hs01_00067856 predicted 395
3 SASI_Hs01_00067857 predicted 294
4 SASI_Hs01_00067858 predicted 287
5 SASI_Hs01_00067859 predicted 691
6 SASI_Hs01_00067860 predicted 336
7 SASI_Hs01_00067861 predicted 684
8 SASI_Hs01_00067862 predicted 243
9 SASI_Hs01_00067863 predicted 816
10 SASI_Hs02_00351148 predicted 325
11 SASI_Hs01_00067854 predicted 315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009705 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038877 predicted 921
2 SASI_Rn01_00038878 predicted 886
3 SASI_Rn01_00038879 predicted 238
4 SASI_Rn01_00038880 predicted 1046
5 SASI_Rn01_00038881 predicted 1076
6 SASI_Rn01_00038882 predicted 223
7 SASI_Rn01_00038883 predicted 723
8 SASI_Rn01_00038884 predicted 1072
9 SASI_Rn01_00038885 predicted 639
10 SASI_Rn01_00038886 predicted 897
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025504 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126809 predicted 1112
2 SASI_Mm01_00126810 predicted 1269
3 SASI_Mm01_00126811 predicted 1454
4 SASI_Mm01_00126812 predicted 1300
5 SASI_Mm01_00126813 predicted 1262
6 SASI_Mm01_00126814 predicted 1179
7 SASI_Mm01_00126815 predicted 2064
8 SASI_Mm01_00126816 predicted 1255
9 SASI_Mm01_00126817 predicted 1322
10 SASI_Mm01_00126818 predicted 1276
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025504
ATP5SL MISSION shRNA Bacterial Glycerol Stock
ATP5S-like
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025504.4-1187s21c1
Sequence:CCGGAGGAGAAATATGGCCCGTATGCTCGAGCATACGGGCCATATTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025504.4-1081s21c1
Sequence:CCGGCAGTTCCTCTCAGATCATTTCCTCGAGGAAATGATCTGAGAGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025504.4-1080s1c1
Sequence:CCGGGCAGTTCCTCTCAGATCATTTCTCGAGAAATGATCTGAGAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025504.4-1797s21c1
Sequence:CCGGGGCTTCTGGTGTAGCTCATTCCTCGAGGAATGAGCTACACCAGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025504.2-1111s1c1
Sequence:CCGGCCAGACTCTGAGAGAGTACTTCTCGAGAAGTACTCTCTCAGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025504.2-2044s1c1
Sequence:CCGGCCATGGCATTACCCATTGATTCTCGAGAATCAATGGGTAATGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025504.2-1279s1c1
Sequence:CCGGGCCAAATAACCGTAGCCATTTCTCGAGAAATGGCTACGGTTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025504.2-2168s1c1
Sequence:CCGGCCGGAGAGAATCCAAAGTAAACTCGAGTTTACTTTGGATTCTCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025504.2-1307s1c1
Sequence:CCGGGAGATTCAGAAGTTCCAGAATCTCGAGATTCTGGAACTTCTGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025504
ATP5SL MISSION shRNA shRNA Plasmid DNA
ATP5S-like
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025504.4-1187s21c1
Sequence:CCGGAGGAGAAATATGGCCCGTATGCTCGAGCATACGGGCCATATTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025504.4-1081s21c1
Sequence:CCGGCAGTTCCTCTCAGATCATTTCCTCGAGGAAATGATCTGAGAGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025504.4-1080s1c1
Sequence:CCGGGCAGTTCCTCTCAGATCATTTCTCGAGAAATGATCTGAGAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025504.4-1797s21c1
Sequence:CCGGGGCTTCTGGTGTAGCTCATTCCTCGAGGAATGAGCTACACCAGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025504.2-1111s1c1
Sequence:CCGGCCAGACTCTGAGAGAGTACTTCTCGAGAAGTACTCTCTCAGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025504.2-2044s1c1
Sequence:CCGGCCATGGCATTACCCATTGATTCTCGAGAATCAATGGGTAATGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025504.2-1279s1c1
Sequence:CCGGGCCAAATAACCGTAGCCATTTCTCGAGAAATGGCTACGGTTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025504.2-2168s1c1
Sequence:CCGGCCGGAGAGAATCCAAAGTAAACTCGAGTTTACTTTGGATTCTCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025504.2-1307s1c1
Sequence:CCGGGAGATTCAGAAGTTCCAGAATCTCGAGATTCTGGAACTTCTGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025504
ATP5SL MISSION shRNA Lentiviral Transduction Particles
ATP5S-like
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025504.4-1187s21c1
Sequence:CCGGAGGAGAAATATGGCCCGTATGCTCGAGCATACGGGCCATATTTCTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025504.4-1081s21c1
Sequence:CCGGCAGTTCCTCTCAGATCATTTCCTCGAGGAAATGATCTGAGAGGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217615    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025504.4-1080s1c1
Sequence:CCGGGCAGTTCCTCTCAGATCATTTCTCGAGAAATGATCTGAGAGGAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422319    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025504.4-1797s21c1
Sequence:CCGGGGCTTCTGGTGTAGCTCATTCCTCGAGGAATGAGCTACACCAGAAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025504.2-1111s1c1
Sequence:CCGGCCAGACTCTGAGAGAGTACTTCTCGAGAAGTACTCTCTCAGAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025504.2-2044s1c1
Sequence:CCGGCCATGGCATTACCCATTGATTCTCGAGAATCAATGGGTAATGCCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025504.2-1279s1c1
Sequence:CCGGGCCAAATAACCGTAGCCATTTCTCGAGAAATGGCTACGGTTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177887    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025504.2-2168s1c1
Sequence:CCGGCCGGAGAGAATCCAAAGTAAACTCGAGTTTACTTTGGATTCTCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197948    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025504.2-1307s1c1
Sequence:CCGGGAGATTCAGAAGTTCCAGAATCTCGAGATTCTGGAACTTCTGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018035
VALIDATED
ATP5SL MISSION shRNA Bacterial Glycerol Stock
ATP5S-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000122546    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018035.1-844s1c1
Sequence:CCGGCCACACTTCTGGCTTCCATTTCTCGAGAAATGGAAGCCAGAAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018035.1-654s1c1
Sequence:CCGGCCTCACTCAGATATTGGTGGACTCGAGTCCACCAATATCTGAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018035.1-918s1c1
Sequence:CCGGGCGTGAGTTCCCAGTATTTATCTCGAGATAAATACTGGGAACTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018035.1-132s1c1
Sequence:CCGGCCAGTTCCTGACCAACTATTTCTCGAGAAATAGTTGGTCAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018035.1-238s1c1
Sequence:CCGGGAGAAGCAACATGGTCCATACCTCGAGGTATGGACCATGTTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018035.1-294s1c1
Sequence:CCGGCGCAGTCAAGTTTCGAGACAACTCGAGTTGTCTCGAAACTTGACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018035.1-399s1c1
Sequence:CCGGCGGTGACTGTGACATCAACTACTCGAGTAGTTGATGTCACAGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018035.1-1394s1c1
Sequence:CCGGCCTTCGTGGTTCTTGTTGGTTCTCGAGAACCAACAAGAACCACGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018035.1-355s1c1
Sequence:CCGGGAGTTCTGGAATTTCTGTGAACTCGAGTTCACAGAAATTCCAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018035.1-856s1c1
Sequence:CCGGCTTCCATTTGTCTTCACTCAACTCGAGTTGAGTGAAGACAAATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018035
VALIDATED
ATP5SL MISSION shRNA shRNA Plasmid DNA
ATP5S-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000122546    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018035.1-844s1c1
Sequence:CCGGCCACACTTCTGGCTTCCATTTCTCGAGAAATGGAAGCCAGAAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018035.1-654s1c1
Sequence:CCGGCCTCACTCAGATATTGGTGGACTCGAGTCCACCAATATCTGAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018035.1-918s1c1
Sequence:CCGGGCGTGAGTTCCCAGTATTTATCTCGAGATAAATACTGGGAACTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018035.1-132s1c1
Sequence:CCGGCCAGTTCCTGACCAACTATTTCTCGAGAAATAGTTGGTCAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018035.1-238s1c1
Sequence:CCGGGAGAAGCAACATGGTCCATACCTCGAGGTATGGACCATGTTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018035.1-294s1c1
Sequence:CCGGCGCAGTCAAGTTTCGAGACAACTCGAGTTGTCTCGAAACTTGACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018035.1-399s1c1
Sequence:CCGGCGGTGACTGTGACATCAACTACTCGAGTAGTTGATGTCACAGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018035.1-1394s1c1
Sequence:CCGGCCTTCGTGGTTCTTGTTGGTTCTCGAGAACCAACAAGAACCACGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018035.1-355s1c1
Sequence:CCGGGAGTTCTGGAATTTCTGTGAACTCGAGTTCACAGAAATTCCAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018035.1-856s1c1
Sequence:CCGGCTTCCATTTGTCTTCACTCAACTCGAGTTGAGTGAAGACAAATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018035
VALIDATED
ATP5SL MISSION shRNA Lentiviral Transduction Particles
ATP5S-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000122546    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018035.1-844s1c1
Sequence:CCGGCCACACTTCTGGCTTCCATTTCTCGAGAAATGGAAGCCAGAAGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018035.1-654s1c1
Sequence:CCGGCCTCACTCAGATATTGGTGGACTCGAGTCCACCAATATCTGAGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122456    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018035.1-918s1c1
Sequence:CCGGGCGTGAGTTCCCAGTATTTATCTCGAGATAAATACTGGGAACTCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018035.1-132s1c1
Sequence:CCGGCCAGTTCCTGACCAACTATTTCTCGAGAAATAGTTGGTCAGGAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142394    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018035.1-238s1c1
Sequence:CCGGGAGAAGCAACATGGTCCATACCTCGAGGTATGGACCATGTTGCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018035.1-294s1c1
Sequence:CCGGCGCAGTCAAGTTTCGAGACAACTCGAGTTGTCTCGAAACTTGACTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141535    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018035.1-399s1c1
Sequence:CCGGCGGTGACTGTGACATCAACTACTCGAGTAGTTGATGTCACAGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_018035.1-1394s1c1
Sequence:CCGGCCTTCGTGGTTCTTGTTGGTTCTCGAGAACCAACAAGAACCACGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018035.1-355s1c1
Sequence:CCGGGAGTTCTGGAATTTCTGTGAACTCGAGTTCACAGAAATTCCAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018035.1-856s1c1
Sequence:CCGGCTTCCATTTGTCTTCACTCAACTCGAGTTGAGTGAAGACAAATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks