EMAIL THIS PAGE TO A FRIEND

ATP6AP1

ATPase, H+ transporting, lysosomal accessory protein 1

79 Gene Product Result for
Synonyms: 16A ATP6IP1 ATP6S1 Ac45 CF2 VATPS1 XAP-3 XAP3
UniProtKB ID: Q15904, A6ZKI4
Gene ID:
Human(537) Summary: This gene encodes a component of a multisubunit enzyme (1 mDa MW) that mediates acidification of eukaryotic intracellular organelles. Vacuolar ATPase (V-ATPase) is comprised of a cytosolic V1 (site of the ATP catalytic site) and a transmembrane V0 domain. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. The encoded protein of this gene is approximately 45 kD and may assist in the V-ATPase-mediated acidification of neuroendocrine secretory granules. [provided by RefSeq, Jul 2008]
Mouse(54411) ATPase, H+ transporting, lysosomal accessory protein 1
Rat(83615) ATPase, H+ transporting, lysosomal accessory protein 1
chicken(427854) ATPase, H+ transporting, lysosomal accessory protein 1
cow(327687) ATPase, H+ transporting, lysosomal accessory protein 1
Horse(100630677) ATPase, H+ transporting, lysosomal accessory protein 1
domestic cat(101091770) ATPase, H+ transporting, lysosomal accessory protein 1
dog(610922) ATPase, H+ transporting, lysosomal accessory protein 1
naked mole-rat(101705200) ATPase, H+ transporting, lysosomal accessory protein 1
domestic guinea pig(100724336) ATPase, H+ transporting, lysosomal accessory protein 1
sheep(101119886) ATPase, H+ transporting, lysosomal accessory protein 1
Domestic Rabbit(100328760) ATPase, H+ transporting, lysosomal accessory protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018794 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018794 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018794 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001183 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001183 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001183 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001183 Rosetta Predictions human pricing
NM_031785 Rosetta Predictions rat pricing
NM_018794 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001183 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151228 predicted 1747
2 SASI_Hs01_00151229 predicted 1444
3 SASI_Hs01_00151230 predicted 488
4 SASI_Hs01_00151231 predicted 1384
5 SASI_Hs01_00151233 predicted 811
6 SASI_Hs01_00151234 predicted 804
7 SASI_Hs01_00151237 predicted 1649
8 SASI_Hs02_00331312 predicted 1002
9 SASI_Hs02_00331313 predicted 1173
10 SASI_Hs02_00331314 predicted 705
11 SASI_Hs01_00151232 predicted 1665
12 SASI_Hs01_00151235 predicted 474
13 SASI_Hs01_00151236 predicted 1748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031785 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265225 predicted 812
2 SASI_Rn01_00111951 predicted 626
3 SASI_Rn01_00111952 predicted 981
4 SASI_Rn01_00111953 predicted 1381
5 SASI_Rn01_00111954 predicted 272
6 SASI_Rn01_00111955 predicted 897
7 SASI_Rn01_00111956 predicted 1408
8 SASI_Rn01_00111957 predicted 653
9 SASI_Rn01_00111958 predicted 1116
10 SASI_Rn01_00111959 predicted 473
11 SASI_Rn01_00111960 predicted 1300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018794 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117924 predicted 1036
2 SASI_Mm02_00324110 predicted 874
3 SASI_Mm02_00324111 predicted 856
4 SASI_Mm02_00324112 predicted 842
5 SASI_Mm01_00117930 predicted 1145
6 SASI_Mm02_00324113 predicted 952
7 SASI_Mm02_00324114 predicted 201
8 SASI_Mm02_00324115 predicted 639
9 SASI_Mm02_00324116 predicted 828
10 SASI_Mm02_00324117 predicted 930
11 SASI_Mm01_00117925 predicted 1463
12 SASI_Mm01_00117926 predicted 209
13 SASI_Mm01_00117927 predicted 878
14 SASI_Mm01_00117928 predicted 1445
15 SASI_Mm01_00117929 predicted 1437
16 SASI_Mm01_00117931 predicted 1422
17 SASI_Mm01_00117932 predicted 277
18 SASI_Mm01_00117933 predicted 1332
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018794
VALIDATED
ATP6AP1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal accessory protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018794.2-1746s1c1
Sequence:CCGGCCTTGCTGTTTATAGTGCTTTCTCGAGAAAGCACTATAAACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018794.2-845s1c1
Sequence:CCGGGCATACAAAGACGAGTGGAAACTCGAGTTTCCACTCGTCTTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018794.2-1345s1c1
Sequence:CCGGGCACATGATACTCAGCCTAAACTCGAGTTTAGGCTGAGTATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018794.2-275s1c1
Sequence:CCGGCGTAATGTACTGCTGTTCCTACTCGAGTAGGAACAGCAGTACATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018794.2-1076s1c1
Sequence:CCGGGCCCATTTCAATGTTTCCCAACTCGAGTTGGGAAACATTGAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018794.3-1075s21c1
Sequence:CCGGGCCCATTTCAATGTTTCCCAACTCGAGTTGGGAAACATTGAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018794.3-1745s21c1
Sequence:CCGGCCTTGCTGTTTATAGTGCTTTCTCGAGAAAGCACTATAAACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018794.3-1344s21c1
Sequence:CCGGGCACATGATACTCAGCCTAAACTCGAGTTTAGGCTGAGTATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018794.3-844s21c1
Sequence:CCGGGCATACAAAGACGAGTGGAAACTCGAGTTTCCACTCGTCTTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018794.3-274s21c1
Sequence:CCGGCGTAATGTACTGCTGTTCCTACTCGAGTAGGAACAGCAGTACATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018794
VALIDATED
ATP6AP1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal accessory protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018794.2-1746s1c1
Sequence:CCGGCCTTGCTGTTTATAGTGCTTTCTCGAGAAAGCACTATAAACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018794.2-845s1c1
Sequence:CCGGGCATACAAAGACGAGTGGAAACTCGAGTTTCCACTCGTCTTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018794.2-1345s1c1
Sequence:CCGGGCACATGATACTCAGCCTAAACTCGAGTTTAGGCTGAGTATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018794.2-275s1c1
Sequence:CCGGCGTAATGTACTGCTGTTCCTACTCGAGTAGGAACAGCAGTACATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018794.2-1076s1c1
Sequence:CCGGGCCCATTTCAATGTTTCCCAACTCGAGTTGGGAAACATTGAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018794.3-1075s21c1
Sequence:CCGGGCCCATTTCAATGTTTCCCAACTCGAGTTGGGAAACATTGAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018794.3-1745s21c1
Sequence:CCGGCCTTGCTGTTTATAGTGCTTTCTCGAGAAAGCACTATAAACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018794.3-1344s21c1
Sequence:CCGGGCACATGATACTCAGCCTAAACTCGAGTTTAGGCTGAGTATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018794.3-844s21c1
Sequence:CCGGGCATACAAAGACGAGTGGAAACTCGAGTTTCCACTCGTCTTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018794.3-274s21c1
Sequence:CCGGCGTAATGTACTGCTGTTCCTACTCGAGTAGGAACAGCAGTACATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018794
VALIDATED
ATP6AP1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal accessory protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103660    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018794.2-1746s1c1
Sequence:CCGGCCTTGCTGTTTATAGTGCTTTCTCGAGAAAGCACTATAAACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018794.2-845s1c1
Sequence:CCGGGCATACAAAGACGAGTGGAAACTCGAGTTTCCACTCGTCTTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018794.2-1345s1c1
Sequence:CCGGGCACATGATACTCAGCCTAAACTCGAGTTTAGGCTGAGTATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018794.2-275s1c1
Sequence:CCGGCGTAATGTACTGCTGTTCCTACTCGAGTAGGAACAGCAGTACATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018794.2-1076s1c1
Sequence:CCGGGCCCATTTCAATGTTTCCCAACTCGAGTTGGGAAACATTGAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018794.3-1075s21c1
Sequence:CCGGGCCCATTTCAATGTTTCCCAACTCGAGTTGGGAAACATTGAAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302643    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018794.3-1745s21c1
Sequence:CCGGCCTTGCTGTTTATAGTGCTTTCTCGAGAAAGCACTATAAACAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018794.3-1344s21c1
Sequence:CCGGGCACATGATACTCAGCCTAAACTCGAGTTTAGGCTGAGTATCATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018794.3-844s21c1
Sequence:CCGGGCATACAAAGACGAGTGGAAACTCGAGTTTCCACTCGTCTTTGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018794.3-274s21c1
Sequence:CCGGCGTAATGTACTGCTGTTCCTACTCGAGTAGGAACAGCAGTACATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001183
VALIDATED
ATP6AP1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal accessory protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001183.3-949s1c1
Sequence:CCGGCTGACCTATGAACGACTCTTTCTCGAGAAAGAGTCGTTCATAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001183.3-311s1c1
Sequence:CCGGGCATTGAGGATTTCACAGCATCTCGAGATGCTGTGAAATCCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001183.3-1048s1c1
Sequence:CCGGCGCCTCGAAGTCCACAGCAATCTCGAGATTGCTGTGGACTTCGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001183.3-976s1c1
Sequence:CCGGACAGTGACATTCAAGTTCATTCTCGAGAATGAACTTGAATGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001183.3-1404s1c1
Sequence:CCGGCACTATTTCTTTGACCCAGATCTCGAGATCTGGGTCAAAGAAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-354s21c1
Sequence:CCGGGCATTGAGGATTTCACAGCATCTCGAGATGCTGTGAAATCCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-1264s21c1
Sequence:CCGGGATCCAGGCTTTCAACGTAATCTCGAGATTACGTTGAAAGCCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-1019s21c1
Sequence:CCGGACAGTGACATTCAAGTTCATTCTCGAGAATGAACTTGAATGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-1931s21c1
Sequence:CCGGTAAGAAGTACACGGGTTTATTCTCGAGAATAAACCCGTGTACTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-276s21c1
Sequence:CCGGTGCAGCTCTCTACCTACTTAGCTCGAGCTAAGTAGGTAGAGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001183
VALIDATED
ATP6AP1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal accessory protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001183.3-949s1c1
Sequence:CCGGCTGACCTATGAACGACTCTTTCTCGAGAAAGAGTCGTTCATAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001183.3-311s1c1
Sequence:CCGGGCATTGAGGATTTCACAGCATCTCGAGATGCTGTGAAATCCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001183.3-1048s1c1
Sequence:CCGGCGCCTCGAAGTCCACAGCAATCTCGAGATTGCTGTGGACTTCGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001183.3-976s1c1
Sequence:CCGGACAGTGACATTCAAGTTCATTCTCGAGAATGAACTTGAATGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001183.3-1404s1c1
Sequence:CCGGCACTATTTCTTTGACCCAGATCTCGAGATCTGGGTCAAAGAAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-354s21c1
Sequence:CCGGGCATTGAGGATTTCACAGCATCTCGAGATGCTGTGAAATCCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-1264s21c1
Sequence:CCGGGATCCAGGCTTTCAACGTAATCTCGAGATTACGTTGAAAGCCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-1019s21c1
Sequence:CCGGACAGTGACATTCAAGTTCATTCTCGAGAATGAACTTGAATGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-1931s21c1
Sequence:CCGGTAAGAAGTACACGGGTTTATTCTCGAGAATAAACCCGTGTACTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-276s21c1
Sequence:CCGGTGCAGCTCTCTACCTACTTAGCTCGAGCTAAGTAGGTAGAGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001183
VALIDATED
ATP6AP1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal accessory protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001183.3-949s1c1
Sequence:CCGGCTGACCTATGAACGACTCTTTCTCGAGAAAGAGTCGTTCATAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001183.3-311s1c1
Sequence:CCGGGCATTGAGGATTTCACAGCATCTCGAGATGCTGTGAAATCCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001183.3-1048s1c1
Sequence:CCGGCGCCTCGAAGTCCACAGCAATCTCGAGATTGCTGTGGACTTCGAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001183.3-976s1c1
Sequence:CCGGACAGTGACATTCAAGTTCATTCTCGAGAATGAACTTGAATGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001183.3-1404s1c1
Sequence:CCGGCACTATTTCTTTGACCCAGATCTCGAGATCTGGGTCAAAGAAATAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-354s21c1
Sequence:CCGGGCATTGAGGATTTCACAGCATCTCGAGATGCTGTGAAATCCTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296861    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-1264s21c1
Sequence:CCGGGATCCAGGCTTTCAACGTAATCTCGAGATTACGTTGAAAGCCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-1019s21c1
Sequence:CCGGACAGTGACATTCAAGTTCATTCTCGAGAATGAACTTGAATGTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-1931s21c1
Sequence:CCGGTAAGAAGTACACGGGTTTATTCTCGAGAATAAACCCGTGTACTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296859    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_001183.4-276s21c1
Sequence:CCGGTGCAGCTCTCTACCTACTTAGCTCGAGCTAAGTAGGTAGAGAGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks