EMAIL THIS PAGE TO A FRIEND

ATP6AP1L

ATPase, H+ transporting, lysosomal accessory protein 1-like

58 Gene Product Result for
UniProtKB ID: Q52LC2
Gene ID:
Mouse(435376) ATPase, H+ transporting, lysosomal accessory protein 1-like
Rat(361875) ATPase, H+ transporting, lysosomal accessory protein 1-like
chicken(427324) ATPase, H+ transporting, lysosomal accessory protein 1-like
cow(510390) ATPase, H+ transporting, lysosomal accessory protein 1-like
domestic cat(101093163) ATPase, H+ transporting, lysosomal accessory protein 1-like
dog(610097) ATPase, H+ transporting, lysosomal accessory protein 1-like
sheep(101123629) ATPase, H+ transporting, lysosomal accessory protein 1-like
domestic guinea pig(100728664) ATPase, H+ transporting, lysosomal accessory protein 1-like
naked mole-rat(101708965) ATPase, H+ transporting, lysosomal accessory protein 1-like
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001017971 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017971 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017971 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001145879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001145879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001145879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017971 Rosetta Predictions human pricing
XM_001065086 Rosetta Predictions rat pricing
XM_342169 Rosetta Predictions rat pricing
XM_487300 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189638 predicted 355
2 SASI_Hs01_00189639 predicted 287
3 SASI_Hs01_00189640 predicted 263
4 SASI_Hs01_00189641 predicted 294
5 SASI_Hs01_00189642 predicted 452
6 SASI_Hs01_00189643 predicted 236
7 SASI_Hs01_00189644 predicted 376
8 SASI_Hs01_00189645 predicted 240
9 SASI_Hs01_00189647 predicted 505
10 SASI_Hs02_00306849 predicted 264
11 SASI_Hs01_00189646 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312812 predicted 645
2 SASI_Rn02_00312813 predicted 477
3 SASI_Rn02_00312814 predicted 209
4 SASI_Rn02_00312815 predicted 511
5 SASI_Rn02_00312816 predicted 294
6 SASI_Rn02_00312817 predicted 691
7 SASI_Rn02_00312818 predicted 384
8 SASI_Rn02_00312819 predicted 673
9 SASI_Rn02_00312820 predicted 480
10 SASI_Rn02_00312821 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00171058 predicted 646
2 SASI_Rn01_00171059 predicted 480
3 SASI_Rn01_00171060 predicted 205
4 SASI_Rn01_00171061 predicted 515
5 SASI_Rn02_00393851 predicted 290
6 SASI_Rn02_00393852 predicted 696
7 SASI_Rn01_00171062 predicted 391
8 SASI_Rn01_00171063 predicted 668
9 SASI_Rn01_00171064 predicted 487
10 SASI_Rn01_00171065 predicted 790
11 SASI_Rn01_00171066 predicted 289
12 SASI_Rn01_00171067 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_487300 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218031 predicted 465
2 SASI_Mm01_00218033 predicted 337
3 SASI_Mm01_00218034 predicted 290
4 SASI_Mm02_00426959 predicted 299
5 SASI_Mm01_00218035 predicted 444
6 SASI_Mm01_00218036 predicted 330
7 SASI_Mm01_00218037 predicted 365
8 SASI_Mm01_00218038 predicted 408
9 SASI_Mm01_00218039 predicted 220
10 SASI_Mm02_00426960 predicted 245
11 SASI_Mm01_00218030 predicted 344
12 SASI_Mm01_00218032 predicted 417
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017971
ATP6AP1L MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal accessory protein 1-like
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-296s21c1
Sequence:CCGGGTATATGCTCCCTCTGGTTACCTCGAGGTAACCAGAGGGAGCATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-191s21c1
Sequence:CCGGATCCTTACCAATTACAACAAGCTCGAGCTTGTTGTAATTGGTAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-454s21c1
Sequence:CCGGACGATTTACCAAAGCCCAAGACTCGAGTCTTGGGCTTTGGTAAATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-562s21c1
Sequence:CCGGGCTCATCTACCTGCGGTATCTCTCGAGAGATACCGCAGGTAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-501s21c1
Sequence:CCGGTTCTGATCGGCCTGGCAATGTCTCGAGACATTGCCAGGCCGATCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-682s21c1
Sequence:CCGGTGAATGCTATAAACTGAGAAGCTCGAGCTTCTCAGTTTATAGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017971.1-217s1c1
Sequence:CCGGCATCCAGAGTTGGTTTAGTTTCTCGAGAAACTAAACCAACTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017971.1-127s1c1
Sequence:CCGGCTCCAAATGGTTGTCTTTGAACTCGAGTTCAAAGACAACCATTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017971.1-262s1c1
Sequence:CCGGCAATTCAATCCAAGCAGTCTTCTCGAGAAGACTGCTTGGATTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017971.1-168s1c1
Sequence:CCGGCCAGAAGTCTTGCTATAAGATCTCGAGATCTTATAGCAAGACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017971.1-124s1c1
Sequence:CCGGCAACTCCAAATGGTTGTCTTTCTCGAGAAAGACAACCATTTGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017971.1-295s1c1
Sequence:CCGGCGTATATGCTCCCTCTGGTTACTCGAGTAACCAGAGGGAGCATATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017971.1-190s1c1
Sequence:CCGGCATCCTTACCAATTACAACAACTCGAGTTGTTGTAATTGGTAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017971
ATP6AP1L MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal accessory protein 1-like
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-296s21c1
Sequence:CCGGGTATATGCTCCCTCTGGTTACCTCGAGGTAACCAGAGGGAGCATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-191s21c1
Sequence:CCGGATCCTTACCAATTACAACAAGCTCGAGCTTGTTGTAATTGGTAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-454s21c1
Sequence:CCGGACGATTTACCAAAGCCCAAGACTCGAGTCTTGGGCTTTGGTAAATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-562s21c1
Sequence:CCGGGCTCATCTACCTGCGGTATCTCTCGAGAGATACCGCAGGTAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-501s21c1
Sequence:CCGGTTCTGATCGGCCTGGCAATGTCTCGAGACATTGCCAGGCCGATCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-682s21c1
Sequence:CCGGTGAATGCTATAAACTGAGAAGCTCGAGCTTCTCAGTTTATAGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017971.1-217s1c1
Sequence:CCGGCATCCAGAGTTGGTTTAGTTTCTCGAGAAACTAAACCAACTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017971.1-127s1c1
Sequence:CCGGCTCCAAATGGTTGTCTTTGAACTCGAGTTCAAAGACAACCATTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017971.1-262s1c1
Sequence:CCGGCAATTCAATCCAAGCAGTCTTCTCGAGAAGACTGCTTGGATTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017971.1-168s1c1
Sequence:CCGGCCAGAAGTCTTGCTATAAGATCTCGAGATCTTATAGCAAGACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017971.1-124s1c1
Sequence:CCGGCAACTCCAAATGGTTGTCTTTCTCGAGAAAGACAACCATTTGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017971.1-295s1c1
Sequence:CCGGCGTATATGCTCCCTCTGGTTACTCGAGTAACCAGAGGGAGCATATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017971.1-190s1c1
Sequence:CCGGCATCCTTACCAATTACAACAACTCGAGTTGTTGTAATTGGTAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017971
ATP6AP1L MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal accessory protein 1-like
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-296s21c1
Sequence:CCGGGTATATGCTCCCTCTGGTTACCTCGAGGTAACCAGAGGGAGCATATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-191s21c1
Sequence:CCGGATCCTTACCAATTACAACAAGCTCGAGCTTGTTGTAATTGGTAAGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-454s21c1
Sequence:CCGGACGATTTACCAAAGCCCAAGACTCGAGTCTTGGGCTTTGGTAAATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-562s21c1
Sequence:CCGGGCTCATCTACCTGCGGTATCTCTCGAGAGATACCGCAGGTAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-501s21c1
Sequence:CCGGTTCTGATCGGCCTGGCAATGTCTCGAGACATTGCCAGGCCGATCAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017971.1-682s21c1
Sequence:CCGGTGAATGCTATAAACTGAGAAGCTCGAGCTTCTCAGTTTATAGCATTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017971.1-217s1c1
Sequence:CCGGCATCCAGAGTTGGTTTAGTTTCTCGAGAAACTAAACCAACTCTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147054    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017971.1-127s1c1
Sequence:CCGGCTCCAAATGGTTGTCTTTGAACTCGAGTTCAAAGACAACCATTTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147180    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017971.1-262s1c1
Sequence:CCGGCAATTCAATCCAAGCAGTCTTCTCGAGAAGACTGCTTGGATTGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001017971.1-168s1c1
Sequence:CCGGCCAGAAGTCTTGCTATAAGATCTCGAGATCTTATAGCAAGACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183096    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017971.1-124s1c1
Sequence:CCGGCAACTCCAAATGGTTGTCTTTCTCGAGAAAGACAACCATTTGGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180129    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017971.1-295s1c1
Sequence:CCGGCGTATATGCTCCCTCTGGTTACTCGAGTAACCAGAGGGAGCATATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182902    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001017971.1-190s1c1
Sequence:CCGGCATCCTTACCAATTACAACAACTCGAGTTGTTGTAATTGGTAAGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001145879
ATP6AP1L MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal accessory protein 1-like
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000347330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-528s21c1
Sequence:CCGGACGGTTCACCCTAACCAATTACTCGAGTAATTGGTTAGGGTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-742s21c1
Sequence:CCGGCTGTGGGAGGTCACGTTTATTCTCGAGAATAAACGTGACCTCCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-578s21c1
Sequence:CCGGGTTTACACCGCGTCGAGATAACTCGAGTTATCTCGACGCGGTGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-918s21c1
Sequence:CCGGGCGCTATCTGGACCGTCATTACTCGAGTAATGACGGTCCAGATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-625s21c1
Sequence:CCGGTTTAACGCAACCGGTATATATCTCGAGATATATACCGGTTGCGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001145879
ATP6AP1L MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal accessory protein 1-like
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000347330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-528s21c1
Sequence:CCGGACGGTTCACCCTAACCAATTACTCGAGTAATTGGTTAGGGTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-742s21c1
Sequence:CCGGCTGTGGGAGGTCACGTTTATTCTCGAGAATAAACGTGACCTCCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-578s21c1
Sequence:CCGGGTTTACACCGCGTCGAGATAACTCGAGTTATCTCGACGCGGTGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-918s21c1
Sequence:CCGGGCGCTATCTGGACCGTCATTACTCGAGTAATGACGGTCCAGATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-625s21c1
Sequence:CCGGTTTAACGCAACCGGTATATATCTCGAGATATATACCGGTTGCGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001145879
ATP6AP1L MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal accessory protein 1-like
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000347330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-528s21c1
Sequence:CCGGACGGTTCACCCTAACCAATTACTCGAGTAATTGGTTAGGGTGAACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-742s21c1
Sequence:CCGGCTGTGGGAGGTCACGTTTATTCTCGAGAATAAACGTGACCTCCCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-578s21c1
Sequence:CCGGGTTTACACCGCGTCGAGATAACTCGAGTTATCTCGACGCGGTGTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-918s21c1
Sequence:CCGGGCGCTATCTGGACCGTCATTACTCGAGTAATGACGGTCCAGATAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001145879.1-625s21c1
Sequence:CCGGTTTAACGCAACCGGTATATATCTCGAGATATATACCGGTTGCGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks