EMAIL THIS PAGE TO A FRIEND

ATP6AP2

ATPase, H+ transporting, lysosomal accessory protein 2

107 Gene Product Result for
Synonyms: APT6M8-9 ATP6IP2 ATP6M8-9 ELDF10 M8-9 MRXE MSTP009 XMRE
Gene ID:
Human(10159) Summary: This gene encodes a protein that is associated with adenosine triphosphatases (ATPases). Proton-translocating ATPases have fundamental roles in energy conservation, secondary active transport, acidification of intracellular compartments, and cellular pH homeostasis. There are three classes of ATPases- F, P, and V. The vacuolar (V-type) ATPases have a transmembrane proton-conducting sector and an extramembrane catalytic sector. The encoded protein has been found associated with the transmembrane sector of the V-type ATPases. [provided by RefSeq, Jul 2008]
Mouse(70495) ATPase, H+ transporting, lysosomal accessory protein 2
Rat(302526) ATPase, H+ transporting, lysosomal accessory protein 2
naked mole-rat(101703484) ATPase, H+ transporting, lysosomal accessory protein 2
domestic guinea pig(100732838) ATPase, H+ transporting, lysosomal accessory protein 2
sheep(101103453) ATPase, H+ transporting, lysosomal accessory protein 2
Zebrafish(406296) ATPase, H+ transporting, lysosomal accessory protein 2
cow(513520) ATPase, H+ transporting, lysosomal accessory protein 2
domestic cat(101089582) ATPase, H+ transporting, lysosomal accessory protein 2
chicken(418573) ATPase, H+ transporting, lysosomal accessory protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027439 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027439 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027439 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005765 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005765 Rosetta Predictions human pricing
XM_001060853 Rosetta Predictions rat pricing
XM_217592 Rosetta Predictions rat pricing
NM_027439 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147062 predicted 411
2 SASI_Hs01_00147063 predicted 496
3 SASI_Hs01_00147064 predicted 697
4 SASI_Hs01_00147065 predicted 422
5 SASI_Hs02_00340242 predicted 712
6 SASI_Hs01_00147066 predicted 927
7 SASI_Hs01_00147068 predicted 972
8 SASI_Hs01_00147069 predicted 198
9 SASI_Hs01_00147071 predicted 788
10 SASI_Hs02_00340243 predicted 837
11 SASI_Hs01_00147067 predicted 861
12 SASI_Hs01_00147070 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060853 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00297930 predicted 1128
2 SASI_Rn02_00297931 predicted 306
3 SASI_Rn02_00297932 predicted 1313
4 SASI_Rn02_00297933 predicted 483
5 SASI_Rn02_00297934 predicted 762
6 SASI_Rn02_00297935 predicted 549
7 SASI_Rn02_00297936 predicted 1209
8 SASI_Rn02_00297937 predicted 1239
9 SASI_Rn02_00297938 predicted 702
10 SASI_Rn02_00297939 predicted 1325
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217592 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377235 predicted 845
2 SASI_Rn02_00377236 predicted 672
3 SASI_Rn02_00377237 predicted 582
4 SASI_Rn02_00377238 predicted 480
5 SASI_Rn02_00377239 predicted 759
6 SASI_Rn02_00377240 predicted 546
7 SASI_Rn02_00377241 predicted 995
8 SASI_Rn02_00377242 predicted 703
9 SASI_Rn02_00377243 predicted 926
10 SASI_Rn02_00377244 predicted 850
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027439 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00332193 predicted 449
2 SASI_Mm01_00100154 predicted 656
3 SASI_Mm01_00100155 predicted 1063
4 SASI_Mm01_00100156 predicted 620
5 SASI_Mm01_00100157 predicted 997
6 SASI_Mm01_00100159 predicted 543
7 SASI_Mm01_00100160 predicted 348
8 SASI_Mm01_00100161 predicted 251
9 SASI_Mm01_00100162 predicted 907
10 SASI_Mm02_00332194 predicted 1053
11 SASI_Mm01_00100158 predicted 1031
12 SASI_Mm01_00100163 predicted 764
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027439
VALIDATED
ATP6AP2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal accessory protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000175364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_027439.2-1663s1c1
Sequence:CCGGCCGTGTGGTTTAGTAGAGATACTCGAGTATCTCTACTAAACCACACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_027439.2-624s1c1
Sequence:CCGGCCAGTTTGTTGTCTCGTCATACTCGAGTATGACGAGACAACAAACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_027439.2-1828s1c1
Sequence:CCGGCCTGTGAAGTTACTCTTGGTTCTCGAGAACCAAGAGTAACTTCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027439.3-1027s21c1
Sequence:CCGGTATGGATCCTGGATATGATAGCTCGAGCTATCATATCCAGGATCCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027439.3-1002s21c1
Sequence:CCGGTAATCACCTCTTACAACATTTCTCGAGAAATGTTGTAAGAGGTGATTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027439.3-1065s1c1
Sequence:CCGGCAAATCAGAAGATTCGAATAGCTCGAGCTATTCGAATCTTCTGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_027439.3-898s1c1
Sequence:CCGGGAACACCCAAAGTCCTTATAACTCGAGTTATAAGGACTTTGGGTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027439.3-86s21c1
Sequence:CCGGGGGAATGAATTTAGCATATTACTCGAGTAATATGCTAAATTCATTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027439.3-1860s21c1
Sequence:CCGGCTTCAATCTGTAGACTATTATCTCGAGATAATAGTCTACAGATTGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027439.3-131s21c1
Sequence:CCGGCGAAATGGAAATTGGCCTATACTCGAGTATAGGCCAATTTCCATTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027439
VALIDATED
ATP6AP2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal accessory protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000175364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_027439.2-1663s1c1
Sequence:CCGGCCGTGTGGTTTAGTAGAGATACTCGAGTATCTCTACTAAACCACACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000175365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_027439.2-624s1c1
Sequence:CCGGCCAGTTTGTTGTCTCGTCATACTCGAGTATGACGAGACAACAAACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000193938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_027439.2-1828s1c1
Sequence:CCGGCCTGTGAAGTTACTCTTGGTTCTCGAGAACCAAGAGTAACTTCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027439.3-1027s21c1
Sequence:CCGGTATGGATCCTGGATATGATAGCTCGAGCTATCATATCCAGGATCCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027439.3-1002s21c1
Sequence:CCGGTAATCACCTCTTACAACATTTCTCGAGAAATGTTGTAAGAGGTGATTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027439.3-1065s1c1
Sequence:CCGGCAAATCAGAAGATTCGAATAGCTCGAGCTATTCGAATCTTCTGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000215540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_027439.3-898s1c1
Sequence:CCGGGAACACCCAAAGTCCTTATAACTCGAGTTATAAGGACTTTGGGTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027439.3-86s21c1
Sequence:CCGGGGGAATGAATTTAGCATATTACTCGAGTAATATGCTAAATTCATTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027439.3-1860s21c1
Sequence:CCGGCTTCAATCTGTAGACTATTATCTCGAGATAATAGTCTACAGATTGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027439.3-131s21c1
Sequence:CCGGCGAAATGGAAATTGGCCTATACTCGAGTATAGGCCAATTTCCATTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027439
VALIDATED
ATP6AP2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal accessory protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000175364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_027439.2-1663s1c1
Sequence:CCGGCCGTGTGGTTTAGTAGAGATACTCGAGTATCTCTACTAAACCACACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000175365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_027439.2-624s1c1
Sequence:CCGGCCAGTTTGTTGTCTCGTCATACTCGAGTATGACGAGACAACAAACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000193938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_027439.2-1828s1c1
Sequence:CCGGCCTGTGAAGTTACTCTTGGTTCTCGAGAACCAAGAGTAACTTCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027439.3-1027s21c1
Sequence:CCGGTATGGATCCTGGATATGATAGCTCGAGCTATCATATCCAGGATCCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027439.3-1002s21c1
Sequence:CCGGTAATCACCTCTTACAACATTTCTCGAGAAATGTTGTAAGAGGTGATTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215361    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027439.3-1065s1c1
Sequence:CCGGCAAATCAGAAGATTCGAATAGCTCGAGCTATTCGAATCTTCTGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000215540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_027439.3-898s1c1
Sequence:CCGGGAACACCCAAAGTCCTTATAACTCGAGTTATAAGGACTTTGGGTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027439.3-86s21c1
Sequence:CCGGGGGAATGAATTTAGCATATTACTCGAGTAATATGCTAAATTCATTCCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_027439.3-1860s21c1
Sequence:CCGGCTTCAATCTGTAGACTATTATCTCGAGATAATAGTCTACAGATTGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027439.3-131s21c1
Sequence:CCGGCGAAATGGAAATTGGCCTATACTCGAGTATAGGCCAATTTCCATTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005765
VALIDATED
ATP6AP2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal accessory protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005765.2-1099s1c1
Sequence:CCGGCCTGGATATGATAGCATCATTCTCGAGAATGATGCTATCATATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005765.2-374s1c1
Sequence:CCGGGCAGTGTCATTTCGTACCCTTCTCGAGAAGGGTACGAAATGACACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005765.2-292s1c1
Sequence:CCGGGCAGTGGGTAACCTGTTTCATCTCGAGATGAAACAGGTTACCCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005765.2-1112s1c1
Sequence:CCGGGCATCATTTATAGGATGACAACTCGAGTTGTCATCCTATAAATGATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005765.2-415s21c1
Sequence:CCGGAGTCTTGACAGTGTTGCAAATCTCGAGATTTGCAACACTGTCAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005765.2-1099s21c1
Sequence:CCGGCCTGGATATGATAGCATCATTCTCGAGAATGATGCTATCATATCCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005765.2-1310s21c1
Sequence:CCGGCTAGAGTGAATTATAGTATTGCTCGAGCAATACTATAATTCACTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005765.2-149s21c1
Sequence:CCGGGGAACGAGTTTAGTATATTAACTCGAGTTAATATACTAAACTCGTTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005765.2-292s21c1
Sequence:CCGGGCAGTGGGTAACCTGTTTCATCTCGAGATGAAACAGGTTACCCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005765
VALIDATED
ATP6AP2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal accessory protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005765.2-1099s1c1
Sequence:CCGGCCTGGATATGATAGCATCATTCTCGAGAATGATGCTATCATATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005765.2-374s1c1
Sequence:CCGGGCAGTGTCATTTCGTACCCTTCTCGAGAAGGGTACGAAATGACACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005765.2-292s1c1
Sequence:CCGGGCAGTGGGTAACCTGTTTCATCTCGAGATGAAACAGGTTACCCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005765.2-1112s1c1
Sequence:CCGGGCATCATTTATAGGATGACAACTCGAGTTGTCATCCTATAAATGATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000308100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005765.2-415s21c1
Sequence:CCGGAGTCTTGACAGTGTTGCAAATCTCGAGATTTGCAACACTGTCAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005765.2-1099s21c1
Sequence:CCGGCCTGGATATGATAGCATCATTCTCGAGAATGATGCTATCATATCCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005765.2-1310s21c1
Sequence:CCGGCTAGAGTGAATTATAGTATTGCTCGAGCAATACTATAATTCACTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005765.2-149s21c1
Sequence:CCGGGGAACGAGTTTAGTATATTAACTCGAGTTAATATACTAAACTCGTTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005765.2-292s21c1
Sequence:CCGGGCAGTGGGTAACCTGTTTCATCTCGAGATGAAACAGGTTACCCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005765
VALIDATED
ATP6AP2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal accessory protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005765.2-1099s1c1
Sequence:CCGGCCTGGATATGATAGCATCATTCTCGAGAATGATGCTATCATATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038605    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_005765.2-374s1c1
Sequence:CCGGGCAGTGTCATTTCGTACCCTTCTCGAGAAGGGTACGAAATGACACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005765.2-292s1c1
Sequence:CCGGGCAGTGGGTAACCTGTTTCATCTCGAGATGAAACAGGTTACCCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005765.2-1112s1c1
Sequence:CCGGGCATCATTTATAGGATGACAACTCGAGTTGTCATCCTATAAATGATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000308100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_005765.2-415s21c1
Sequence:CCGGAGTCTTGACAGTGTTGCAAATCTCGAGATTTGCAACACTGTCAAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_005765.2-1099s21c1
Sequence:CCGGCCTGGATATGATAGCATCATTCTCGAGAATGATGCTATCATATCCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296225    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005765.2-1310s21c1
Sequence:CCGGCTAGAGTGAATTATAGTATTGCTCGAGCAATACTATAATTCACTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005765.2-149s21c1
Sequence:CCGGGGAACGAGTTTAGTATATTAACTCGAGTTAATATACTAAACTCGTTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005765.2-292s21c1
Sequence:CCGGGCAGTGGGTAACCTGTTTCATCTCGAGATGAAACAGGTTACCCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)