EMAIL THIS PAGE TO A FRIEND

ATP6V0A1

ATPase, H+ transporting, lysosomal V0 subunit a1

74 Gene Product Result for
Synonyms: ATP6N1 ATP6N1A Stv1 VPP1 Vph1 a1
UniProtKB ID: Q93050, B7Z3B7, Q8N5G7, Q9NSX0
Gene ID:
Human(535) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(11975) ATPase, H+ transporting, lysosomal V0 subunit A1
Rat(29757) ATPase, H+ transporting, lysosomal V0 subunit A1
Zebrafish(100332691) ATPase, H+ transporting, lysosomal V0 subunit a1
cow(286768) ATPase, H+ transporting, lysosomal V0 subunit a1
Horse(100052802) ATPase, H+ transporting, lysosomal V0 subunit a1
domestic cat(101096367) ATPase, H+ transporting, lysosomal V0 subunit a1
dog(607705) ATPase, H+ transporting, lysosomal V0 subunit a1
chicken(395474) ATPase, H+ transporting, lysosomal V0 subunit a1
sheep(101123476) ATPase, H+ transporting, lysosomal V0 subunit a1
domestic guinea pig(100717816) ATPase, H+ transporting, lysosomal V0 subunit a1
naked mole-rat(101718747) ATPase, H+ transporting, lysosomal V0 subunit a1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0250 AQUA Peptide NFLELTEL[K] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat pricing
AQ0251 AQUA Peptide HLGTLNFGGI[R] cow, dog, human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005177 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005177 Rosetta Predictions human pricing
NM_031604 Rosetta Predictions rat pricing
NM_016920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130191 predicted 2109
2 SASI_Hs01_00130192 predicted 1734
3 SASI_Hs01_00130193 predicted 1545
4 SASI_Hs01_00130194 predicted 1952
5 SASI_Hs01_00130196 predicted 1907
6 SASI_Hs01_00130197 predicted 1015
7 SASI_Hs01_00130198 predicted 739
8 SASI_Hs02_00339125 predicted 1381
9 SASI_Hs02_00339126 predicted 1327
10 SASI_Hs01_00130200 predicted 331
11 SASI_Hs01_00130195 predicted 957
12 SASI_Hs01_00130199 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031604 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00037870 predicted 1567
2 SASI_Rn01_00037871 predicted 1479
3 SASI_Rn01_00037872 predicted 1597
4 SASI_Rn01_00037873 predicted 1295
5 SASI_Rn01_00037874 predicted 2562
6 SASI_Rn01_00037875 predicted 2286
7 SASI_Rn01_00037876 predicted 376
8 SASI_Rn01_00037877 predicted 2242
9 SASI_Rn01_00037879 predicted 1526
10 SASI_Rn02_00264883 predicted 955
11 SASI_Rn01_00037878 predicted 1702
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111914 predicted 1541
2 SASI_Mm01_00111915 predicted 1498
3 SASI_Mm01_00111917 predicted 232
4 SASI_Mm01_00111918 predicted 2298
5 SASI_Mm02_00323783 predicted 346
6 SASI_Mm01_00111919 predicted 2260
7 SASI_Mm01_00111921 predicted 1734
8 SASI_Mm01_00111922 predicted 403
9 SASI_Mm01_00111923 predicted 2183
10 SASI_Mm02_00323784 predicted 1512
11 SASI_Mm01_00111916 predicted 1292
12 SASI_Mm01_00111920 predicted 819
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016920
VALIDATED
ATP6V0A1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal V0 subunit a1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-2353s21c1
Sequence:GTACCGGGAGTACTGCTTGGGTTGTATCCTCGAGGATACAACCCAAGCAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-2033s21c1
Sequence:GTACCGGCCTACCCAGAGTCTGGTAATGCTCGAGCATTACCAGACTCTGGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-275s21c1
Sequence:CCGGAGGTCCAATTTCGGGATTTAACTCGAGTTAAATCCCGAAATTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-1248s21c1
Sequence:CCGGCCAGACACCGCCGACATATAACTCGAGTTATATGTCGGCGGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016920.2-3748s21c1
Sequence:CCGGCCTGTGGAAGTGACACTAAATCTCGAGATTTAGTGTCACTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-1297s21c1
Sequence:CCGGCAGAACATAGTAGATGCTTATCTCGAGATAAGCATCTACTATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-1322s21c1
Sequence:CCGGTCGGCACTTACCGAGAGATTACTCGAGTAATCTCTCGGTAAGTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-3721s1c1
Sequence:CCGGCCTGTGGAAGTGACACTAAATCTCGAGATTTAGTGTCACTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-1485s1c1
Sequence:CCGGCCGGTACATTATTCTTCTGATCTCGAGATCAGAAGAATAATGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-2100s1c1
Sequence:CCGGGCTTCTGTTTAAGCCGCTGATCTCGAGATCAGCGGCTTAAACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-1270s1c1
Sequence:CCGGCAGAACATAGTAGATGCTTATCTCGAGATAAGCATCTACTATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-439s1c1
Sequence:CCGGGAGGCCAATTTCGAGAAGATTCTCGAGAATCTTCTCGAAATTGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016920
VALIDATED
ATP6V0A1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal V0 subunit a1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-2353s21c1
Sequence:GTACCGGGAGTACTGCTTGGGTTGTATCCTCGAGGATACAACCCAAGCAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-2033s21c1
Sequence:GTACCGGCCTACCCAGAGTCTGGTAATGCTCGAGCATTACCAGACTCTGGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-275s21c1
Sequence:CCGGAGGTCCAATTTCGGGATTTAACTCGAGTTAAATCCCGAAATTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-1248s21c1
Sequence:CCGGCCAGACACCGCCGACATATAACTCGAGTTATATGTCGGCGGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016920.2-3748s21c1
Sequence:CCGGCCTGTGGAAGTGACACTAAATCTCGAGATTTAGTGTCACTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-1297s21c1
Sequence:CCGGCAGAACATAGTAGATGCTTATCTCGAGATAAGCATCTACTATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-1322s21c1
Sequence:CCGGTCGGCACTTACCGAGAGATTACTCGAGTAATCTCTCGGTAAGTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-3721s1c1
Sequence:CCGGCCTGTGGAAGTGACACTAAATCTCGAGATTTAGTGTCACTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-1485s1c1
Sequence:CCGGCCGGTACATTATTCTTCTGATCTCGAGATCAGAAGAATAATGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-2100s1c1
Sequence:CCGGGCTTCTGTTTAAGCCGCTGATCTCGAGATCAGCGGCTTAAACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-1270s1c1
Sequence:CCGGCAGAACATAGTAGATGCTTATCTCGAGATAAGCATCTACTATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-439s1c1
Sequence:CCGGGAGGCCAATTTCGAGAAGATTCTCGAGAATCTTCTCGAAATTGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016920
VALIDATED
ATP6V0A1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal V0 subunit a1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-2353s21c1
Sequence:GTACCGGGAGTACTGCTTGGGTTGTATCCTCGAGGATACAACCCAAGCAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-2033s21c1
Sequence:GTACCGGCCTACCCAGAGTCTGGTAATGCTCGAGCATTACCAGACTCTGGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-275s21c1
Sequence:CCGGAGGTCCAATTTCGGGATTTAACTCGAGTTAAATCCCGAAATTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-1248s21c1
Sequence:CCGGCCAGACACCGCCGACATATAACTCGAGTTATATGTCGGCGGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288502    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016920.2-3748s21c1
Sequence:CCGGCCTGTGGAAGTGACACTAAATCTCGAGATTTAGTGTCACTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-1297s21c1
Sequence:CCGGCAGAACATAGTAGATGCTTATCTCGAGATAAGCATCTACTATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016920.2-1322s21c1
Sequence:CCGGTCGGCACTTACCGAGAGATTACTCGAGTAATCTCTCGGTAAGTGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101515    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-3721s1c1
Sequence:CCGGCCTGTGGAAGTGACACTAAATCTCGAGATTTAGTGTCACTTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101516    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-1485s1c1
Sequence:CCGGCCGGTACATTATTCTTCTGATCTCGAGATCAGAAGAATAATGTACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-2100s1c1
Sequence:CCGGGCTTCTGTTTAAGCCGCTGATCTCGAGATCAGCGGCTTAAACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-1270s1c1
Sequence:CCGGCAGAACATAGTAGATGCTTATCTCGAGATAAGCATCTACTATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016920.1-439s1c1
Sequence:CCGGGAGGCCAATTTCGAGAAGATTCTCGAGAATCTTCTCGAAATTGGCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005177
VALIDATED
ATP6V0A1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal V0 subunit a1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005177.3-2775s21c1
Sequence:GTACCGGCACCCTGTCTGTGAGTCATTTCTCGAGAAATGACTCACAGACAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005177.3-2027s21c1
Sequence:CCGGCCCAGAGTCTGGTTATTCAATCTCGAGATTGAATAACCAGACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005177.3-2143s21c1
Sequence:CCGGGCCGTCAGTATTTGAGGAGAACTCGAGTTCTCCTCAAATACTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005177.3-1861s21c1
Sequence:CCGGCCCTGAATATCTACTTTGGATCTCGAGATCCAAAGTAGATATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005177.3-955s21c1
Sequence:CCGGCCAGGATTGATGATCTCCAAACTCGAGTTTGGAGATCATCAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_005177.3-3154s21c1
Sequence:GTACCGGGGGTCCAGGAAGATGATATTTCTCGAGAAATATCATCTTCCTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005177.3-3048s21c1
Sequence:GTACCGGTGCATCTGCCACCGTAGTTTCCTCGAGGAAACTACGGTGGCAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-955s1c1
Sequence:CCGGCCAGGATTGATGATCTCCAAACTCGAGTTTGGAGATCATCAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-533s1c1
Sequence:CCGGCCTGGAACTGACCGAATTAAACTCGAGTTTAATTCGGTCAGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-2143s1c1
Sequence:CCGGGCCGTCAGTATTTGAGGAGAACTCGAGTTCTCCTCAAATACTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-1861s1c1
Sequence:CCGGCCCTGAATATCTACTTTGGATCTCGAGATCCAAAGTAGATATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-2027s1c1
Sequence:CCGGCCCAGAGTCTGGTTATTCAATCTCGAGATTGAATAACCAGACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005177
VALIDATED
ATP6V0A1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal V0 subunit a1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005177.3-2775s21c1
Sequence:GTACCGGCACCCTGTCTGTGAGTCATTTCTCGAGAAATGACTCACAGACAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005177.3-2027s21c1
Sequence:CCGGCCCAGAGTCTGGTTATTCAATCTCGAGATTGAATAACCAGACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005177.3-2143s21c1
Sequence:CCGGGCCGTCAGTATTTGAGGAGAACTCGAGTTCTCCTCAAATACTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005177.3-1861s21c1
Sequence:CCGGCCCTGAATATCTACTTTGGATCTCGAGATCCAAAGTAGATATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005177.3-955s21c1
Sequence:CCGGCCAGGATTGATGATCTCCAAACTCGAGTTTGGAGATCATCAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_005177.3-3154s21c1
Sequence:GTACCGGGGGTCCAGGAAGATGATATTTCTCGAGAAATATCATCTTCCTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005177.3-3048s21c1
Sequence:GTACCGGTGCATCTGCCACCGTAGTTTCCTCGAGGAAACTACGGTGGCAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-955s1c1
Sequence:CCGGCCAGGATTGATGATCTCCAAACTCGAGTTTGGAGATCATCAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-533s1c1
Sequence:CCGGCCTGGAACTGACCGAATTAAACTCGAGTTTAATTCGGTCAGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-2143s1c1
Sequence:CCGGGCCGTCAGTATTTGAGGAGAACTCGAGTTCTCCTCAAATACTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-1861s1c1
Sequence:CCGGCCCTGAATATCTACTTTGGATCTCGAGATCCAAAGTAGATATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-2027s1c1
Sequence:CCGGCCCAGAGTCTGGTTATTCAATCTCGAGATTGAATAACCAGACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005177
VALIDATED
ATP6V0A1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal V0 subunit a1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_005177.3-2775s21c1
Sequence:GTACCGGCACCCTGTCTGTGAGTCATTTCTCGAGAAATGACTCACAGACAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005177.3-2027s21c1
Sequence:CCGGCCCAGAGTCTGGTTATTCAATCTCGAGATTGAATAACCAGACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005177.3-2143s21c1
Sequence:CCGGGCCGTCAGTATTTGAGGAGAACTCGAGTTCTCCTCAAATACTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005177.3-1861s21c1
Sequence:CCGGCCCTGAATATCTACTTTGGATCTCGAGATCCAAAGTAGATATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005177.3-955s21c1
Sequence:CCGGCCAGGATTGATGATCTCCAAACTCGAGTTTGGAGATCATCAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_005177.3-3154s21c1
Sequence:GTACCGGGGGTCCAGGAAGATGATATTTCTCGAGAAATATCATCTTCCTGGACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381113    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_005177.3-3048s21c1
Sequence:GTACCGGTGCATCTGCCACCGTAGTTTCCTCGAGGAAACTACGGTGGCAGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-955s1c1
Sequence:CCGGCCAGGATTGATGATCTCCAAACTCGAGTTTGGAGATCATCAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-533s1c1
Sequence:CCGGCCTGGAACTGACCGAATTAAACTCGAGTTTAATTCGGTCAGTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-2143s1c1
Sequence:CCGGGCCGTCAGTATTTGAGGAGAACTCGAGTTCTCCTCAAATACTGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-1861s1c1
Sequence:CCGGCCCTGAATATCTACTTTGGATCTCGAGATCCAAAGTAGATATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005177.2-2027s1c1
Sequence:CCGGCCCAGAGTCTGGTTATTCAATCTCGAGATTGAATAACCAGACTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks