EMAIL THIS PAGE TO A FRIEND

ATP6V0A2

ATPase, H+ transporting, lysosomal V0 subunit a2

65 Gene Product Result for
Synonyms: A2 ARCL ARCL2A ATP6A2 ATP6N1D J6B7 RTF STV1 TJ6 TJ6M TJ6S VPH1 WSS
UniProtKB ID: Q9Y487, A8K026, Q6NUM0
Gene ID:
Human(23545) Summary: The protein encoded by this gene is a subunit of the vacuolar ATPase (v-ATPase), an heteromultimeric enzyme that is present in intracellular vesicles and in the plasma membrane of specialized cells, and which is essential for the acidification of diverse cellular components. V-ATPase is comprised of a membrane peripheral V(1) domain for ATP hydrolysis, and an integral membrane V(0) domain for proton translocation. The subunit encoded by this gene is a component of the V(0) domain. Mutations in this gene are a cause of both cutis laxa type II and wrinkly skin syndrome. [provided by RefSeq, Jul 2009]
Mouse(21871) ATPase, H+ transporting, lysosomal V0 subunit A2
Rat(116455) ATPase, H+ transporting, lysosomal V0 subunit A2
chicken(395473) ATPase, H+ transporting, lysosomal V0 subunit a2
domestic cat(101084995) ATPase, H+ transporting, lysosomal V0 subunit a2
cow(338038) ATPase, H+ transporting, lysosomal V0 subunit a2
Horse(100061140) ATPase, H+ transporting, lysosomal V0 subunit a2
dog(486245) ATPase, H+ transporting, lysosomal V0 subunit a2
naked mole-rat(101700877) ATPase, H+ transporting, lysosomal V0 subunit a2
domestic guinea pig(101787762) ATPase, H+ transporting, lysosomal V0 subunit a2
sheep(101121550) ATPase, H+ transporting, lysosomal V0 subunit a2
Domestic Rabbit(100125983) ATPase, H+ transporting, lysosomal V0 subunit a2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011596 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011596 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011596 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012463 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012463 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012463 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012463 Rosetta Predictions human pricing
NM_053775 Rosetta Predictions rat pricing
XM_001078952 Rosetta Predictions rat pricing
NM_011596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012463 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105607 predicted 1089
2 SASI_Hs01_00105609 predicted 938
3 SASI_Hs01_00105610 predicted 2886
4 SASI_Hs02_00344374 predicted 1358
5 SASI_Hs01_00105612 predicted 2595
6 SASI_Hs01_00105613 predicted 1418
7 SASI_Hs02_00344375 predicted 2326
8 SASI_Hs01_00105615 predicted 850
9 SASI_Hs01_00105616 predicted 706
10 SASI_Hs02_00344376 predicted 2817
11 SASI_Hs01_00105608 predicted 1556
12 SASI_Hs01_00105611 predicted 1406
13 SASI_Hs01_00105614 predicted 2844
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053775 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059569 predicted 886
2 SASI_Rn02_00266576 predicted 1725
3 SASI_Rn01_00059571 predicted 2157
4 SASI_Rn01_00059572 predicted 423
5 SASI_Rn01_00059573 predicted 2138
6 SASI_Rn01_00059574 predicted 693
7 SASI_Rn01_00059575 predicted 1274
8 SASI_Rn01_00059576 predicted 1553
9 SASI_Rn01_00059577 predicted 1329
10 SASI_Rn01_00059578 predicted 544
11 SASI_Rn01_00059570 predicted 603
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00362620 predicted 4871
2 SASI_Rn02_00362621 predicted 2696
3 SASI_Rn02_00362622 predicted 5642
4 SASI_Rn02_00362623 predicted 613
5 SASI_Rn02_00362624 predicted 2237
6 SASI_Rn02_00362625 predicted 2503
7 SASI_Rn02_00362626 predicted 6278
8 SASI_Rn02_00362627 predicted 873
9 SASI_Rn02_00362628 predicted 4937
10 SASI_Rn02_00362629 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029260 predicted 369
2 SASI_Mm02_00321009 predicted 1341
3 SASI_Mm01_00029262 predicted 270
4 SASI_Mm01_00029263 predicted 1379
5 SASI_Mm01_00029264 predicted 1836
6 SASI_Mm01_00029265 predicted 2240
7 SASI_Mm02_00321010 predicted 1642
8 SASI_Mm01_00029266 predicted 740
9 SASI_Mm01_00029267 predicted 535
10 SASI_Mm01_00029268 predicted 2133
11 SASI_Mm01_00029261 predicted 750
12 SASI_Mm01_00029269 predicted 890
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011596
VALIDATED
ATP6V0A2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal V0 subunit a2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011596.1-2711s1c1
Sequence:CCGGGCCAAATGGTTCTGTAAGATACTCGAGTATCTTACAGAACCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011596.1-1744s1c1
Sequence:CCGGGCACTTTAGGAAGAAGTTCAACTCGAGTTGAACTTCTTCCTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011596.1-199s1c1
Sequence:CCGGGCTCGAACGAATACTGGTGTACTCGAGTACACCAGTATTCGTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011596.1-567s1c1
Sequence:CCGGGCAGAGTTGAAGCATTTGAAACTCGAGTTTCAAATGCTTCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011596.1-1292s1c1
Sequence:CCGGGCCCTCTTACTGGTGTTAAATCTCGAGATTTAACACCAGTAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011596.4-287s21c1
Sequence:CCGGGCTCGAACGAATACTGGTGTACTCGAGTACACCAGTATTCGTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011596.4-1832s21c1
Sequence:CCGGGCACTTTAGGAAGAAGTTCAACTCGAGTTGAACTTCTTCCTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011596.4-2802s21c1
Sequence:CCGGGCCAAATGGTTCTGTAAGATACTCGAGTATCTTACAGAACCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011596.4-655s21c1
Sequence:CCGGGCAGAGTTGAAGCATTTGAAACTCGAGTTTCAAATGCTTCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011596
VALIDATED
ATP6V0A2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal V0 subunit a2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011596.1-2711s1c1
Sequence:CCGGGCCAAATGGTTCTGTAAGATACTCGAGTATCTTACAGAACCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011596.1-1744s1c1
Sequence:CCGGGCACTTTAGGAAGAAGTTCAACTCGAGTTGAACTTCTTCCTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011596.1-199s1c1
Sequence:CCGGGCTCGAACGAATACTGGTGTACTCGAGTACACCAGTATTCGTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011596.1-567s1c1
Sequence:CCGGGCAGAGTTGAAGCATTTGAAACTCGAGTTTCAAATGCTTCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011596.1-1292s1c1
Sequence:CCGGGCCCTCTTACTGGTGTTAAATCTCGAGATTTAACACCAGTAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011596.4-287s21c1
Sequence:CCGGGCTCGAACGAATACTGGTGTACTCGAGTACACCAGTATTCGTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011596.4-1832s21c1
Sequence:CCGGGCACTTTAGGAAGAAGTTCAACTCGAGTTGAACTTCTTCCTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011596.4-2802s21c1
Sequence:CCGGGCCAAATGGTTCTGTAAGATACTCGAGTATCTTACAGAACCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011596.4-655s21c1
Sequence:CCGGGCAGAGTTGAAGCATTTGAAACTCGAGTTTCAAATGCTTCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011596
VALIDATED
ATP6V0A2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal V0 subunit a2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101825    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011596.1-2711s1c1
Sequence:CCGGGCCAAATGGTTCTGTAAGATACTCGAGTATCTTACAGAACCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011596.1-1744s1c1
Sequence:CCGGGCACTTTAGGAAGAAGTTCAACTCGAGTTGAACTTCTTCCTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011596.1-199s1c1
Sequence:CCGGGCTCGAACGAATACTGGTGTACTCGAGTACACCAGTATTCGTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101827    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011596.1-567s1c1
Sequence:CCGGGCAGAGTTGAAGCATTTGAAACTCGAGTTTCAAATGCTTCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011596.1-1292s1c1
Sequence:CCGGGCCCTCTTACTGGTGTTAAATCTCGAGATTTAACACCAGTAAGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349185    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011596.4-287s21c1
Sequence:CCGGGCTCGAACGAATACTGGTGTACTCGAGTACACCAGTATTCGTTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011596.4-1832s21c1
Sequence:CCGGGCACTTTAGGAAGAAGTTCAACTCGAGTTGAACTTCTTCCTAAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316441    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011596.4-2802s21c1
Sequence:CCGGGCCAAATGGTTCTGTAAGATACTCGAGTATCTTACAGAACCATTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011596.4-655s21c1
Sequence:CCGGGCAGAGTTGAAGCATTTGAAACTCGAGTTTCAAATGCTTCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012463
VALIDATED
ATP6V0A2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal V0 subunit a2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012463.2-952s1c1
Sequence:CCGGGCCACAAGGTTAAGAAGATATCTCGAGATATCTTCTTAACCTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012463.2-2109s1c1
Sequence:CCGGCCCAGCATTCTGATTGAATTTCTCGAGAAATTCAATCAGAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012463.2-2301s1c1
Sequence:CCGGCGGAGTGGCTACACACTTATACTCGAGTATAAGTGTGTAGCCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012463.2-377s1c1
Sequence:CCGGCGTAAGTTCTTTCCAAAGAAACTCGAGTTTCTTTGGAAAGAACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012463.2-1551s1c1
Sequence:CCGGCCCAGACTAAATCAGTCACAACTCGAGTTGTGACTGATTTAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012463
VALIDATED
ATP6V0A2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal V0 subunit a2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012463.2-952s1c1
Sequence:CCGGGCCACAAGGTTAAGAAGATATCTCGAGATATCTTCTTAACCTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012463.2-2109s1c1
Sequence:CCGGCCCAGCATTCTGATTGAATTTCTCGAGAAATTCAATCAGAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012463.2-2301s1c1
Sequence:CCGGCGGAGTGGCTACACACTTATACTCGAGTATAAGTGTGTAGCCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012463.2-377s1c1
Sequence:CCGGCGTAAGTTCTTTCCAAAGAAACTCGAGTTTCTTTGGAAAGAACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012463.2-1551s1c1
Sequence:CCGGCCCAGACTAAATCAGTCACAACTCGAGTTGTGACTGATTTAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012463
VALIDATED
ATP6V0A2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal V0 subunit a2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_012463.2-952s1c1
Sequence:CCGGGCCACAAGGTTAAGAAGATATCTCGAGATATCTTCTTAACCTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012463.2-2109s1c1
Sequence:CCGGCCCAGCATTCTGATTGAATTTCTCGAGAAATTCAATCAGAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012463.2-2301s1c1
Sequence:CCGGCGGAGTGGCTACACACTTATACTCGAGTATAAGTGTGTAGCCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_012463.2-377s1c1
Sequence:CCGGCGTAAGTTCTTTCCAAAGAAACTCGAGTTTCTTTGGAAAGAACTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_012463.2-1551s1c1
Sequence:CCGGCCCAGACTAAATCAGTCACAACTCGAGTTGTGACTGATTTAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks