EMAIL THIS PAGE TO A FRIEND

ATP6V0A4

ATPase, H+ transporting, lysosomal V0 subunit a4

75 Gene Product Result for
Synonyms: A4 ATP6N1B ATP6N2 RDRTA2 RTA1C RTADR STV1 VPH1 VPP2
UniProtKB ID: Q9HBG4, A4D1R4, A8KA80, Q32M47
Gene ID:
Human(50617) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. This gene is one of four genes in man and mouse that encode different isoforms of the a subunit. Alternatively spliced transcript variants encoding the same protein have been described. Mutations in this gene are associated with renal tubular acidosis associated with preserved hearing. [provided by RefSeq, Jul 2008]
Mouse(140494) ATPase, H+ transporting, lysosomal V0 subunit A4
Rat(296981) ATPase, H+ transporting, lysosomal V0 subunit A4
chicken(418104) ATPase, H+ transporting, lysosomal V0 subunit a4
dog(482779) ATPase, H+ transporting, lysosomal V0 subunit a4
domestic cat(101089593) ATPase, H+ transporting, lysosomal V0 subunit a4
cow(518974) ATPase, H+ transporting, lysosomal V0 subunit a4
Horse(100064797) ATPase, H+ transporting, lysosomal V0 subunit a4
sheep(101104057) ATPase, H+ transporting, lysosomal V0 subunit a4
Domestic Rabbit(100347541) ATPase, H+ transporting, lysosomal V0 subunit a4
domestic guinea pig(100735854) ATPase, H+ transporting, lysosomal V0 subunit a4
naked mole-rat(101719254) ATPase, H+ transporting, lysosomal V0 subunit a4
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020632 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020632 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020632 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080467 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080467 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080467 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020632 Rosetta Predictions human pricing
NM_130840 Rosetta Predictions human pricing
NM_130841 Rosetta Predictions human pricing
NM_001106591 Rosetta Predictions rat pricing
NM_080467 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020632 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124169 predicted 1764
2 SASI_Hs02_00353608 predicted 2338
3 SASI_Hs01_00124170 predicted 1873
4 SASI_Hs01_00124171 predicted 2205
5 SASI_Hs01_00124172 predicted 2071
6 SASI_Hs01_00124173 predicted 1085
7 SASI_Hs01_00124174 predicted 2841
8 SASI_Hs01_00124175 predicted 1622
9 SASI_Hs01_00124177 predicted 1051
10 SASI_Hs02_00353609 predicted 1636
11 SASI_Hs01_00124176 predicted 1990
12 SASI_Hs01_00124178 predicted 1071
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130840 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022642 predicted 1665
2 SASI_Hs02_00362882 predicted 2228
3 SASI_Hs01_00022643 predicted 1775
4 SASI_Hs01_00022644 predicted 2101
5 SASI_Hs01_00022645 predicted 1967
6 SASI_Hs01_00022646 predicted 981
7 SASI_Hs01_00022647 predicted 2740
8 SASI_Hs01_00022648 predicted 1521
9 SASI_Hs01_00022650 predicted 946
10 SASI_Hs02_00362883 predicted 1531
11 SASI_Hs01_00022649 predicted 1892
12 SASI_Hs01_00022651 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130841 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092627 predicted 1715
2 SASI_Hs02_00362884 predicted 2287
3 SASI_Hs01_00092628 predicted 1834
4 SASI_Hs01_00092629 predicted 2158
5 SASI_Hs01_00092630 predicted 2025
6 SASI_Hs01_00092631 predicted 1042
7 SASI_Hs01_00092632 predicted 2799
8 SASI_Hs01_00092633 predicted 1580
9 SASI_Hs01_00092635 predicted 1002
10 SASI_Hs02_00362885 predicted 1594
11 SASI_Hs01_00092634 predicted 1952
12 SASI_Hs01_00092636 predicted 1028
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220458 predicted 1485
2 SASI_Rn02_00220459 predicted 803
3 SASI_Rn02_00220460 predicted 972
4 SASI_Rn02_00220461 predicted 1297
5 SASI_Rn02_00220462 predicted 401
6 SASI_Rn02_00220463 predicted 1820
7 SASI_Rn02_00220464 predicted 1469
8 SASI_Rn02_00220465 predicted 1735
9 SASI_Rn02_00220466 predicted 272
10 SASI_Rn02_00220467 predicted 2754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080467 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00028302 predicted 389
2 SASI_Mm01_00028303 predicted 1825
3 SASI_Mm01_00028304 predicted 903
4 SASI_Mm01_00028305 predicted 974
5 SASI_Mm01_00028307 predicted 697
6 SASI_Mm01_00028306 predicted 288
7 SASI_Mm01_00028308 predicted 1745
8 SASI_Mm01_00028309 predicted 422
9 SASI_Mm01_00028310 predicted 1076
10 SASI_Mm02_00338143 predicted 1619
11 SASI_Mm01_00028311 predicted 1835
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020632
ATP6V0A4 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal V0 subunit a4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000451536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020632.2-1343s21c1
Sequence:CCGGATGACCACAGTGCAATCTAAACTCGAGTTTAGATTGCACTGTGGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020632.2-1087s21c1
Sequence:CCGGAGATTTAATCACCGTCATAACCTCGAGGTTATGACGGTGATTAAATCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020632.1-2938s1c1
Sequence:CCGGCCTGTGGATTTGATACGACTTCTCGAGAAGTCGTATCAAATCCACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020632.1-2539s1c1
Sequence:CCGGGCTCTGGACTATGGTGATGAACTCGAGTTCATCACCATAGTCCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020632.1-754s1c1
Sequence:CCGGGCCTGCATATATGACCGGAAACTCGAGTTTCCGGTCATATATGCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020632.1-1358s1c1
Sequence:CCGGCCCACATTTAACAGGACCAATCTCGAGATTGGTCCTGTTAAATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020632.1-2185s1c1
Sequence:CCGGCCAAAGTTTCTTTGTGGTTATCTCGAGATAACCACAAAGAAACTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020632
ATP6V0A4 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal V0 subunit a4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000451536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020632.2-1343s21c1
Sequence:CCGGATGACCACAGTGCAATCTAAACTCGAGTTTAGATTGCACTGTGGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000447978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020632.2-1087s21c1
Sequence:CCGGAGATTTAATCACCGTCATAACCTCGAGGTTATGACGGTGATTAAATCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020632.1-2938s1c1
Sequence:CCGGCCTGTGGATTTGATACGACTTCTCGAGAAGTCGTATCAAATCCACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020632.1-2539s1c1
Sequence:CCGGGCTCTGGACTATGGTGATGAACTCGAGTTCATCACCATAGTCCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020632.1-754s1c1
Sequence:CCGGGCCTGCATATATGACCGGAAACTCGAGTTTCCGGTCATATATGCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020632.1-1358s1c1
Sequence:CCGGCCCACATTTAACAGGACCAATCTCGAGATTGGTCCTGTTAAATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020632.1-2185s1c1
Sequence:CCGGCCAAAGTTTCTTTGTGGTTATCTCGAGATAACCACAAAGAAACTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020632
ATP6V0A4 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal V0 subunit a4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000451536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020632.2-1343s21c1
Sequence:CCGGATGACCACAGTGCAATCTAAACTCGAGTTTAGATTGCACTGTGGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000447978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020632.2-1087s21c1
Sequence:CCGGAGATTTAATCACCGTCATAACCTCGAGGTTATGACGGTGATTAAATCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020632.1-2938s1c1
Sequence:CCGGCCTGTGGATTTGATACGACTTCTCGAGAAGTCGTATCAAATCCACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020632.1-2539s1c1
Sequence:CCGGGCTCTGGACTATGGTGATGAACTCGAGTTCATCACCATAGTCCAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020632.1-754s1c1
Sequence:CCGGGCCTGCATATATGACCGGAAACTCGAGTTTCCGGTCATATATGCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020632.1-1358s1c1
Sequence:CCGGCCCACATTTAACAGGACCAATCTCGAGATTGGTCCTGTTAAATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020632.1-2185s1c1
Sequence:CCGGCCAAAGTTTCTTTGTGGTTATCTCGAGATAACCACAAAGAAACTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080467
ATP6V0A4 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal V0 subunit a4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080467.2-1971s1c1
Sequence:CCGGCCTCAACATCATTCTGCAATTCTCGAGAATTGCAGAATGATGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080467.2-1941s1c1
Sequence:CCGGCCTCTTCAATCACATTTACTTCTCGAGAAGTAAATGTGATTGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080467.2-2115s1c1
Sequence:CCGGCGGCATGTTTCTGTTCGACTACTCGAGTAGTCGAACAGAAACATGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080467.2-3127s1c1
Sequence:CCGGGCCAAGGATGTCCTTGACTTTCTCGAGAAAGTCAAGGACATCCTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080467.2-1528s1c1
Sequence:CCGGGCCTTGTGGATGGTCCTAAATCTCGAGATTTAGGACCATCCACAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080467
ATP6V0A4 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal V0 subunit a4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080467.2-1971s1c1
Sequence:CCGGCCTCAACATCATTCTGCAATTCTCGAGAATTGCAGAATGATGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080467.2-1941s1c1
Sequence:CCGGCCTCTTCAATCACATTTACTTCTCGAGAAGTAAATGTGATTGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080467.2-2115s1c1
Sequence:CCGGCGGCATGTTTCTGTTCGACTACTCGAGTAGTCGAACAGAAACATGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080467.2-3127s1c1
Sequence:CCGGGCCAAGGATGTCCTTGACTTTCTCGAGAAAGTCAAGGACATCCTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080467.2-1528s1c1
Sequence:CCGGGCCTTGTGGATGGTCCTAAATCTCGAGATTTAGGACCATCCACAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080467
ATP6V0A4 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal V0 subunit a4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080467.2-1971s1c1
Sequence:CCGGCCTCAACATCATTCTGCAATTCTCGAGAATTGCAGAATGATGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080467.2-1941s1c1
Sequence:CCGGCCTCTTCAATCACATTTACTTCTCGAGAAGTAAATGTGATTGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080467.2-2115s1c1
Sequence:CCGGCGGCATGTTTCTGTTCGACTACTCGAGTAGTCGAACAGAAACATGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101385    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_080467.2-3127s1c1
Sequence:CCGGGCCAAGGATGTCCTTGACTTTCTCGAGAAAGTCAAGGACATCCTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080467.2-1528s1c1
Sequence:CCGGGCCTTGTGGATGGTCCTAAATCTCGAGATTTAGGACCATCCACAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)