EMAIL THIS PAGE TO A FRIEND

ATP6V0C

ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c

71 Gene Product Result for
Synonyms: ATP6C ATP6L ATPL VATL VPPC Vma3
UniProtKB ID: P27449, Q6FH26
Gene ID:
Human(527) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c', and d. This gene encodes the V0 subunit c. Alternative splicing results in transcript variants. Pseudogenes have been identified on chromosomes 6 and 17. [provided by RefSeq, Nov 2010]
Mouse(11984) ATPase, H+ transporting, lysosomal V0 subunit C
Rat(170667) ATPase, H+ transporting, lysosomal V0 subunit C
chicken(416753) ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
dog(479877) ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
cow(550622) ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
domestic cat(101101434) ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
sheep(443003) ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
domestic guinea pig(100735418) ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
naked mole-rat(101709243) ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009729 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009729 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009729 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001694 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001694 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001694 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001694 siRNAs that have been validated in the lab human pricing
NM_130823 Rosetta Predictions rat pricing
NM_009729 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001694 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216533 validated 855
2 SASI_Hs01_00216534 predicted 868
3 SASI_Hs01_00216535 predicted 381
4 SASI_Hs01_00216536 predicted 741
5 SASI_Hs01_00216537 predicted 859
6 SASI_Hs01_00216538 predicted 853
7 SASI_Hs01_00216539 predicted 631
8 SASI_Hs01_00216540 predicted 869
9 SASI_Hs01_00216541 predicted 569
10 SASI_Hs02_00332359 predicted 464
11 SASI_Hs01_00216542 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130823 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081205 predicted 871
2 SASI_Rn01_00081206 predicted 590
3 SASI_Rn01_00081207 predicted 747
4 SASI_Rn01_00081208 predicted 390
5 SASI_Rn01_00081209 predicted 900
6 SASI_Rn01_00081210 predicted 396
7 SASI_Rn01_00081211 predicted 317
8 SASI_Rn01_00081212 predicted 847
9 SASI_Rn01_00081213 predicted 883
10 SASI_Rn01_00081214 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009729 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062885 predicted 828
2 SASI_Mm01_00062886 predicted 650
3 SASI_Mm01_00062888 predicted 576
4 SASI_Mm01_00062889 predicted 860
5 SASI_Mm02_00316890 predicted 386
6 SASI_Mm01_00062890 predicted 297
7 SASI_Mm01_00062891 predicted 706
8 SASI_Mm01_00062892 predicted 590
9 SASI_Mm02_00316891 predicted 729
10 SASI_Mm01_00062894 predicted 856
11 SASI_Mm01_00062887 predicted 629
12 SASI_Mm01_00062893 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009729
VALIDATED
ATP6V0C MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009729.3-592s21c1
Sequence:CCGGCCTAATCCTCTCCACAAAGTACTCGAGTACTTTGTGGAGAGGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009729.3-394s21c1
Sequence:CCGGCATCACCCTCTACAGGAGTTTCTCGAGAAACTCCTGTAGAGGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009729.3-295s21c1
Sequence:CCGGGCTGATCATGAAGTCCATCATCTCGAGATGATGGACTTCATGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009729.3-705s21c1
Sequence:CCGGCCTCAGTAGTTGGTCTTGTAACTCGAGTTACAAGACCAACTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009729.1-707s1c1
Sequence:CCGGCCTCAGTAGTTGGTCTTGTAACTCGAGTTACAAGACCAACTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009729.1-318s1c1
Sequence:CCGGCCCAGTGGTTATGGCTGGGATCTCGAGATCCCAGCCATAACCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009729.1-396s1c1
Sequence:CCGGCATCACCCTCTACAGGAGTTTCTCGAGAAACTCCTGTAGAGGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009729.1-594s1c1
Sequence:CCGGCCTAATCCTCTCCACAAAGTACTCGAGTACTTTGTGGAGAGGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009729.1-297s1c1
Sequence:CCGGGCTGATCATGAAGTCCATCATCTCGAGATGATGGACTTCATGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009729
VALIDATED
ATP6V0C MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009729.3-592s21c1
Sequence:CCGGCCTAATCCTCTCCACAAAGTACTCGAGTACTTTGTGGAGAGGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009729.3-394s21c1
Sequence:CCGGCATCACCCTCTACAGGAGTTTCTCGAGAAACTCCTGTAGAGGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009729.3-295s21c1
Sequence:CCGGGCTGATCATGAAGTCCATCATCTCGAGATGATGGACTTCATGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009729.3-705s21c1
Sequence:CCGGCCTCAGTAGTTGGTCTTGTAACTCGAGTTACAAGACCAACTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009729.1-707s1c1
Sequence:CCGGCCTCAGTAGTTGGTCTTGTAACTCGAGTTACAAGACCAACTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009729.1-318s1c1
Sequence:CCGGCCCAGTGGTTATGGCTGGGATCTCGAGATCCCAGCCATAACCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009729.1-396s1c1
Sequence:CCGGCATCACCCTCTACAGGAGTTTCTCGAGAAACTCCTGTAGAGGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009729.1-594s1c1
Sequence:CCGGCCTAATCCTCTCCACAAAGTACTCGAGTACTTTGTGGAGAGGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009729.1-297s1c1
Sequence:CCGGGCTGATCATGAAGTCCATCATCTCGAGATGATGGACTTCATGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009729
VALIDATED
ATP6V0C MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323878    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009729.3-592s21c1
Sequence:CCGGCCTAATCCTCTCCACAAAGTACTCGAGTACTTTGTGGAGAGGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009729.3-394s21c1
Sequence:CCGGCATCACCCTCTACAGGAGTTTCTCGAGAAACTCCTGTAGAGGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009729.3-295s21c1
Sequence:CCGGGCTGATCATGAAGTCCATCATCTCGAGATGATGGACTTCATGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009729.3-705s21c1
Sequence:CCGGCCTCAGTAGTTGGTCTTGTAACTCGAGTTACAAGACCAACTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009729.1-707s1c1
Sequence:CCGGCCTCAGTAGTTGGTCTTGTAACTCGAGTTACAAGACCAACTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009729.1-318s1c1
Sequence:CCGGCCCAGTGGTTATGGCTGGGATCTCGAGATCCCAGCCATAACCACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009729.1-396s1c1
Sequence:CCGGCATCACCCTCTACAGGAGTTTCTCGAGAAACTCCTGTAGAGGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009729.1-594s1c1
Sequence:CCGGCCTAATCCTCTCCACAAAGTACTCGAGTACTTTGTGGAGAGGATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009729.1-297s1c1
Sequence:CCGGGCTGATCATGAAGTCCATCATCTCGAGATGATGGACTTCATGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001694
VALIDATED
ATP6V0C MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000323221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001694.2-572s21c1
Sequence:CCGGGCTCGGCCTCTACGGTCTCATCTCGAGATGAGACCGTAGAGGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001694.2-395s21c1
Sequence:CCGGTGACGACATCAGCCTCTACAACTCGAGTTGTAGAGGCTGATGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001694.2-953s21c1
Sequence:CCGGCTTGTCTCCCAGCTATCTATACTCGAGTATAGATAGCTGGGAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001694.2-238s21c1
Sequence:CCGGGCGCTGCCTATGGCACAGCCACTCGAGTGGCTGTGCCATAGGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-395s1c1
Sequence:CCGGTGACGACATCAGCCTCTACAACTCGAGTTGTAGAGGCTGATGTCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-596s1c1
Sequence:CCGGCGCCCTCATCCTCTCCACAAACTCGAGTTTGTGGAGAGGATGAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-375s1c1
Sequence:CCGGCTCATCGCCAACTCCCTGAATCTCGAGATTCAGGGAGTTGGCGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-238s1c1
Sequence:CCGGGCGCTGCCTATGGCACAGCCACTCGAGTGGCTGTGCCATAGGCAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-572s1c1
Sequence:CCGGGCTCGGCCTCTACGGTCTCATCTCGAGATGAGACCGTAGAGGCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001694
VALIDATED
ATP6V0C MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000323221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001694.2-572s21c1
Sequence:CCGGGCTCGGCCTCTACGGTCTCATCTCGAGATGAGACCGTAGAGGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001694.2-395s21c1
Sequence:CCGGTGACGACATCAGCCTCTACAACTCGAGTTGTAGAGGCTGATGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001694.2-953s21c1
Sequence:CCGGCTTGTCTCCCAGCTATCTATACTCGAGTATAGATAGCTGGGAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001694.2-238s21c1
Sequence:CCGGGCGCTGCCTATGGCACAGCCACTCGAGTGGCTGTGCCATAGGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-395s1c1
Sequence:CCGGTGACGACATCAGCCTCTACAACTCGAGTTGTAGAGGCTGATGTCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-596s1c1
Sequence:CCGGCGCCCTCATCCTCTCCACAAACTCGAGTTTGTGGAGAGGATGAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-375s1c1
Sequence:CCGGCTCATCGCCAACTCCCTGAATCTCGAGATTCAGGGAGTTGGCGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-238s1c1
Sequence:CCGGGCGCTGCCTATGGCACAGCCACTCGAGTGGCTGTGCCATAGGCAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-572s1c1
Sequence:CCGGGCTCGGCCTCTACGGTCTCATCTCGAGATGAGACCGTAGAGGCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001694
VALIDATED
ATP6V0C MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 16kDa, V0 subunit c
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000323221    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001694.2-572s21c1
Sequence:CCGGGCTCGGCCTCTACGGTCTCATCTCGAGATGAGACCGTAGAGGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001694.2-395s21c1
Sequence:CCGGTGACGACATCAGCCTCTACAACTCGAGTTGTAGAGGCTGATGTCGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323222    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001694.2-953s21c1
Sequence:CCGGCTTGTCTCCCAGCTATCTATACTCGAGTATAGATAGCTGGGAGACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001694.2-238s21c1
Sequence:CCGGGCGCTGCCTATGGCACAGCCACTCGAGTGGCTGTGCCATAGGCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-395s1c1
Sequence:CCGGTGACGACATCAGCCTCTACAACTCGAGTTGTAGAGGCTGATGTCGTCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-596s1c1
Sequence:CCGGCGCCCTCATCCTCTCCACAAACTCGAGTTTGTGGAGAGGATGAGGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-375s1c1
Sequence:CCGGCTCATCGCCAACTCCCTGAATCTCGAGATTCAGGGAGTTGGCGATGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-238s1c1
Sequence:CCGGGCGCTGCCTATGGCACAGCCACTCGAGTGGCTGTGCCATAGGCAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_001694.2-572s1c1
Sequence:CCGGGCTCGGCCTCTACGGTCTCATCTCGAGATGAGACCGTAGAGGCCGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks