EMAIL THIS PAGE TO A FRIEND

ATP6V0D1

ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1

61 Gene Product Result for
Synonyms: ATP6D ATP6DV P39 VATX VMA6 VPATPD
UniProtKB ID: P61421, P12953, Q02547
Gene ID:
Human(9114) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is known as the D subunit and is found ubiquitously. [provided by RefSeq, Jul 2008]
Mouse(11972) ATPase, H+ transporting, lysosomal V0 subunit D1
Rat(291969) ATPase, H+ transporting, lysosomal V0 subunit D1
Zebrafish(322811) ATPase, H+ transporting, V0 subunit D isoform 1
cow(282148) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
Horse(100053316) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
domestic cat(101100610) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
dog(479685) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
chicken(415674) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
naked mole-rat(101711869) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
domestic guinea pig(100733139) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
sheep(101108509) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
Domestic Rabbit(100350157) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013477 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013477 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013477 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004691 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004691 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004691 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004691 Rosetta Predictions human pricing
NM_001011927 Rosetta Predictions rat pricing
XM_574227 Rosetta Predictions rat pricing
NM_013477 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004691 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338129 predicted 372
2 SASI_Hs01_00184156 predicted 897
3 SASI_Hs01_00184157 predicted 350
4 SASI_Hs02_00338130 predicted 939
5 SASI_Hs01_00184160 predicted 703
6 SASI_Hs01_00184161 predicted 518
7 SASI_Hs01_00184162 predicted 925
8 SASI_Hs02_00338131 predicted 384
9 SASI_Hs01_00184163 predicted 244
10 SASI_Hs02_00338132 predicted 697
11 SASI_Hs01_00184158 predicted 513
12 SASI_Hs01_00184159 predicted 292
13 SASI_Hs01_00184164 predicted 621
14 SASI_Hs01_00184165 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011927 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072256 predicted 871
2 SASI_Rn01_00072257 predicted 1065
3 SASI_Rn01_00072258 predicted 238
4 SASI_Rn02_00199929 predicted 298
5 SASI_Rn01_00072260 predicted 1119
6 SASI_Rn01_00072261 predicted 740
7 SASI_Rn01_00072262 predicted 636
8 SASI_Rn01_00072263 predicted 706
9 SASI_Rn01_00072264 predicted 217
10 SASI_Rn01_00072265 predicted 866
11 SASI_Rn01_00072259 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574227 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00189163 predicted 1102
2 SASI_Rn01_00189164 predicted 1295
3 SASI_Rn01_00189165 predicted 465
4 SASI_Rn01_00189166 predicted 537
5 SASI_Rn01_00189167 predicted 1351
6 SASI_Rn01_00189168 predicted 974
7 SASI_Rn01_00189169 predicted 862
8 SASI_Rn01_00189170 predicted 943
9 SASI_Rn01_00189171 predicted 452
10 SASI_Rn01_00189172 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158479 predicted 923
2 SASI_Mm01_00158480 predicted 829
3 SASI_Mm01_00158481 predicted 657
4 SASI_Mm01_00158482 predicted 747
5 SASI_Mm01_00158483 predicted 689
6 SASI_Mm01_00158484 predicted 465
7 SASI_Mm01_00158485 predicted 350
8 SASI_Mm01_00158486 predicted 790
9 SASI_Mm01_00158487 predicted 421
10 SASI_Mm01_00158488 predicted 912
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013477
VALIDATED
ATP6V0D1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013477.2-1423s1c1
Sequence:CCGGGCCACTGACATGTCTAAGAAACTCGAGTTTCTTAGACATGTCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013477.2-377s1c1
Sequence:CCGGGCCACATGAGAAACCATGCTTCTCGAGAAGCATGGTTTCTCATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013477.2-917s1c1
Sequence:CCGGAGGTCAAGAATGTAGCTGATTCTCGAGAATCAGCTACATTCTTGACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013477.2-1078s1c1
Sequence:CCGGGCCTTTGTGAAGCTTAAGGAACTCGAGTTCCTTAAGCTTCACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013477.2-916s1c1
Sequence:CCGGCAGGTCAAGAATGTAGCTGATCTCGAGATCAGCTACATTCTTGACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-1422s21c1
Sequence:CCGGGCCACTGACATGTCTAAGAAACTCGAGTTTCTTAGACATGTCAGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-659s21c1
Sequence:CCGGCATCGAGATAATCCGAAATACCTCGAGGTATTTCGGATTATCTCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-376s21c1
Sequence:CCGGGCCACATGAGAAACCATGCTTCTCGAGAAGCATGGTTTCTCATGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-915s21c1
Sequence:CCGGCAGGTCAAGAATGTAGCTGATCTCGAGATCAGCTACATTCTTGACCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-1077s21c1
Sequence:CCGGGCCTTTGTGAAGCTTAAGGAACTCGAGTTCCTTAAGCTTCACAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013477
VALIDATED
ATP6V0D1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013477.2-1423s1c1
Sequence:CCGGGCCACTGACATGTCTAAGAAACTCGAGTTTCTTAGACATGTCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013477.2-377s1c1
Sequence:CCGGGCCACATGAGAAACCATGCTTCTCGAGAAGCATGGTTTCTCATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013477.2-917s1c1
Sequence:CCGGAGGTCAAGAATGTAGCTGATTCTCGAGAATCAGCTACATTCTTGACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013477.2-1078s1c1
Sequence:CCGGGCCTTTGTGAAGCTTAAGGAACTCGAGTTCCTTAAGCTTCACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000101893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013477.2-916s1c1
Sequence:CCGGCAGGTCAAGAATGTAGCTGATCTCGAGATCAGCTACATTCTTGACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-1422s21c1
Sequence:CCGGGCCACTGACATGTCTAAGAAACTCGAGTTTCTTAGACATGTCAGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-659s21c1
Sequence:CCGGCATCGAGATAATCCGAAATACCTCGAGGTATTTCGGATTATCTCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-376s21c1
Sequence:CCGGGCCACATGAGAAACCATGCTTCTCGAGAAGCATGGTTTCTCATGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-915s21c1
Sequence:CCGGCAGGTCAAGAATGTAGCTGATCTCGAGATCAGCTACATTCTTGACCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-1077s21c1
Sequence:CCGGGCCTTTGTGAAGCTTAAGGAACTCGAGTTCCTTAAGCTTCACAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013477
VALIDATED
ATP6V0D1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101890    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013477.2-1423s1c1
Sequence:CCGGGCCACTGACATGTCTAAGAAACTCGAGTTTCTTAGACATGTCAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013477.2-377s1c1
Sequence:CCGGGCCACATGAGAAACCATGCTTCTCGAGAAGCATGGTTTCTCATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013477.2-917s1c1
Sequence:CCGGAGGTCAAGAATGTAGCTGATTCTCGAGAATCAGCTACATTCTTGACCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101894    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013477.2-1078s1c1
Sequence:CCGGGCCTTTGTGAAGCTTAAGGAACTCGAGTTCCTTAAGCTTCACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000101893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013477.2-916s1c1
Sequence:CCGGCAGGTCAAGAATGTAGCTGATCTCGAGATCAGCTACATTCTTGACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-1422s21c1
Sequence:CCGGGCCACTGACATGTCTAAGAAACTCGAGTTTCTTAGACATGTCAGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-659s21c1
Sequence:CCGGCATCGAGATAATCCGAAATACCTCGAGGTATTTCGGATTATCTCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-376s21c1
Sequence:CCGGGCCACATGAGAAACCATGCTTCTCGAGAAGCATGGTTTCTCATGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-915s21c1
Sequence:CCGGCAGGTCAAGAATGTAGCTGATCTCGAGATCAGCTACATTCTTGACCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013477.3-1077s21c1
Sequence:CCGGGCCTTTGTGAAGCTTAAGGAACTCGAGTTCCTTAAGCTTCACAAAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004691
VALIDATED
ATP6V0D1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-1131s1c1
Sequence:CCGGCGACAACTACATCCCTATCTTCTCGAGAAGATAGGGATGTAGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-987s1c1
Sequence:CCGGGCACGAGGTAAAGCTGAACAACTCGAGTTGTTCAGCTTTACCTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-380s1c1
Sequence:CCGGCCAGCTTCCTAGACTTCATTACTCGAGTAATGAAGTCTAGGAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-217s1c1
Sequence:CCGGGAGACGCTAGAGGACTTGAAACTCGAGTTTCAAGTCCTCTAGCGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-876s1c1
Sequence:CCGGCGACTATGAACAGGTCAAGAACTCGAGTTCTTGACCTGTTCATAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-988s21c1
Sequence:CCGGGCACGAGGTAAAGCTGAACAACTCGAGTTGTTCAGCTTTACCTCGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-218s21c1
Sequence:CCGGGAGACGCTAGAGGACTTGAAACTCGAGTTTCAAGTCCTCTAGCGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-877s21c1
Sequence:CCGGCGACTATGAACAGGTCAAGAACTCGAGTTCTTGACCTGTTCATAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-1132s21c1
Sequence:CCGGCGACAACTACATCCCTATCTTCTCGAGAAGATAGGGATGTAGTTGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-381s21c1
Sequence:CCGGCCAGCTTCCTAGACTTCATTACTCGAGTAATGAAGTCTAGGAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004691
VALIDATED
ATP6V0D1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-1131s1c1
Sequence:CCGGCGACAACTACATCCCTATCTTCTCGAGAAGATAGGGATGTAGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-987s1c1
Sequence:CCGGGCACGAGGTAAAGCTGAACAACTCGAGTTGTTCAGCTTTACCTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-380s1c1
Sequence:CCGGCCAGCTTCCTAGACTTCATTACTCGAGTAATGAAGTCTAGGAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-217s1c1
Sequence:CCGGGAGACGCTAGAGGACTTGAAACTCGAGTTTCAAGTCCTCTAGCGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000038557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-876s1c1
Sequence:CCGGCGACTATGAACAGGTCAAGAACTCGAGTTCTTGACCTGTTCATAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-988s21c1
Sequence:CCGGGCACGAGGTAAAGCTGAACAACTCGAGTTGTTCAGCTTTACCTCGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-218s21c1
Sequence:CCGGGAGACGCTAGAGGACTTGAAACTCGAGTTTCAAGTCCTCTAGCGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-877s21c1
Sequence:CCGGCGACTATGAACAGGTCAAGAACTCGAGTTCTTGACCTGTTCATAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-1132s21c1
Sequence:CCGGCGACAACTACATCCCTATCTTCTCGAGAAGATAGGGATGTAGTTGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-381s21c1
Sequence:CCGGCCAGCTTCCTAGACTTCATTACTCGAGTAATGAAGTCTAGGAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004691
VALIDATED
ATP6V0D1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-1131s1c1
Sequence:CCGGCGACAACTACATCCCTATCTTCTCGAGAAGATAGGGATGTAGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038554    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-987s1c1
Sequence:CCGGGCACGAGGTAAAGCTGAACAACTCGAGTTGTTCAGCTTTACCTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-380s1c1
Sequence:CCGGCCAGCTTCCTAGACTTCATTACTCGAGTAATGAAGTCTAGGAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038558    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-217s1c1
Sequence:CCGGGAGACGCTAGAGGACTTGAAACTCGAGTTTCAAGTCCTCTAGCGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000038557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_004691.3-876s1c1
Sequence:CCGGCGACTATGAACAGGTCAAGAACTCGAGTTCTTGACCTGTTCATAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333502    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-988s21c1
Sequence:CCGGGCACGAGGTAAAGCTGAACAACTCGAGTTGTTCAGCTTTACCTCGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-218s21c1
Sequence:CCGGGAGACGCTAGAGGACTTGAAACTCGAGTTTCAAGTCCTCTAGCGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333439    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-877s21c1
Sequence:CCGGCGACTATGAACAGGTCAAGAACTCGAGTTCTTGACCTGTTCATAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-1132s21c1
Sequence:CCGGCGACAACTACATCCCTATCTTCTCGAGAAGATAGGGATGTAGTTGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333438    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004691.4-381s21c1
Sequence:CCGGCCAGCTTCCTAGACTTCATTACTCGAGTAATGAAGTCTAGGAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)