EMAIL THIS PAGE TO A FRIEND

ATP6V0D2

ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2

101 Gene Product Result for
Synonyms: ATP6D2 VMA6
UniProtKB ID: Q8N8Y2
Gene ID:
Mouse(242341) ATPase, H+ transporting, lysosomal V0 subunit D2
Rat(297932) ATPase, H+ transporting, lysosomal V0 subunit D2
sheep(101117677) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
domestic guinea pig(100717063) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
naked mole-rat(101696829) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
chicken(420210) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
dog(477929) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
Horse(100049996) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
cow(511839) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
domestic cat(101095399) ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152565 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU058091 MISSION® esiRNA esiRNA human ATP6V0D2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152565 Rosetta Predictions human pricing
NM_001011972 Rosetta Predictions rat pricing
XM_575782 Rosetta Predictions rat pricing
NM_175406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233291 predicted 343
2 SASI_Hs01_00233292 predicted 623
3 SASI_Hs02_00366381 predicted 665
4 SASI_Hs01_00233293 predicted 301
5 SASI_Hs01_00233294 predicted 1046
6 SASI_Hs01_00233295 predicted 210
7 SASI_Hs01_00233296 predicted 928
8 SASI_Hs01_00233298 predicted 785
9 SASI_Hs01_00233299 predicted 352
10 SASI_Hs01_00233300 predicted 248
11 SASI_Hs01_00233297 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011972 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199994 predicted 396
2 SASI_Rn01_00082630 predicted 745
3 SASI_Rn01_00082631 predicted 338
4 SASI_Rn01_00082632 predicted 316
5 SASI_Rn01_00082633 predicted 847
6 SASI_Rn01_00082634 predicted 637
7 SASI_Rn01_00082635 predicted 1000
8 SASI_Rn01_00082636 predicted 653
9 SASI_Rn01_00082638 predicted 586
10 SASI_Rn01_00082639 predicted 456
11 SASI_Rn01_00082637 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00175195 predicted 206
2 SASI_Rn01_00175196 predicted 267
3 SASI_Rn01_00175197 predicted 219
4 SASI_Rn01_00175198 predicted 280
5 SASI_Rn01_00175199 predicted 279
6 SASI_Rn01_00175200 predicted 207
7 SASI_Rn01_00175201 predicted 245
8 SASI_Rn01_00175202 predicted 242
9 SASI_Rn01_00175203 predicted 283
10 SASI_Rn01_00175204 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094102 predicted 305
2 SASI_Mm01_00094103 predicted 618
3 SASI_Mm01_00094104 predicted 743
4 SASI_Mm01_00094105 predicted 374
5 SASI_Mm01_00094106 predicted 374
6 SASI_Mm01_00094107 predicted 670
7 SASI_Mm01_00094108 predicted 1119
8 SASI_Mm01_00094109 predicted 369
9 SASI_Mm01_00094110 predicted 622
10 SASI_Mm01_00094111 predicted 314
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152565
ATP6V0D2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152565.1-1234s21c1
Sequence:CCGGATATCTTCATGAGTTGCAAATCTCGAGATTTGCAACTCATGAAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152565.1-635s21c1
Sequence:CCGGACCTTGAGGCATTCTATAAATCTCGAGATTTATAGAATGCCTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152565.1-948s21c1
Sequence:CCGGTTACGAGCGTGAGGTACAAATCTCGAGATTTGTACCTCACGCTCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-609s1c1
Sequence:CCGGGCTACGCAATAAACTATACAACTCGAGTTGTATAGTTTATTGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-216s1c1
Sequence:CCGGCCAGACTACTGATTATGGTAACTCGAGTTACCATAATCAGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-1015s1c1
Sequence:CCGGGCATATGTAAAGCTGAAGGAACTCGAGTTCCTTCAGCTTTACATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-360s1c1
Sequence:CCGGCACCTATATGACGTGCAGTTACTCGAGTAACTGCACGTCATATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-682s1c1
Sequence:CCGGGCAGAAGTTATGTGTCCCATTCTCGAGAATGGGACACATAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152565
ATP6V0D2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152565.1-1234s21c1
Sequence:CCGGATATCTTCATGAGTTGCAAATCTCGAGATTTGCAACTCATGAAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152565.1-635s21c1
Sequence:CCGGACCTTGAGGCATTCTATAAATCTCGAGATTTATAGAATGCCTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152565.1-948s21c1
Sequence:CCGGTTACGAGCGTGAGGTACAAATCTCGAGATTTGTACCTCACGCTCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-609s1c1
Sequence:CCGGGCTACGCAATAAACTATACAACTCGAGTTGTATAGTTTATTGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-216s1c1
Sequence:CCGGCCAGACTACTGATTATGGTAACTCGAGTTACCATAATCAGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-1015s1c1
Sequence:CCGGGCATATGTAAAGCTGAAGGAACTCGAGTTCCTTCAGCTTTACATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-360s1c1
Sequence:CCGGCACCTATATGACGTGCAGTTACTCGAGTAACTGCACGTCATATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-682s1c1
Sequence:CCGGGCAGAAGTTATGTGTCCCATTCTCGAGAATGGGACACATAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152565
ATP6V0D2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427557    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_152565.1-1234s21c1
Sequence:CCGGATATCTTCATGAGTTGCAAATCTCGAGATTTGCAACTCATGAAGATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419793    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152565.1-635s21c1
Sequence:CCGGACCTTGAGGCATTCTATAAATCTCGAGATTTATAGAATGCCTCAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152565.1-948s21c1
Sequence:CCGGTTACGAGCGTGAGGTACAAATCTCGAGATTTGTACCTCACGCTCGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-609s1c1
Sequence:CCGGGCTACGCAATAAACTATACAACTCGAGTTGTATAGTTTATTGCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043519    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-216s1c1
Sequence:CCGGCCAGACTACTGATTATGGTAACTCGAGTTACCATAATCAGTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-1015s1c1
Sequence:CCGGGCATATGTAAAGCTGAAGGAACTCGAGTTCCTTCAGCTTTACATATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-360s1c1
Sequence:CCGGCACCTATATGACGTGCAGTTACTCGAGTAACTGCACGTCATATAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152565.1-682s1c1
Sequence:CCGGGCAGAAGTTATGTGTCCCATTCTCGAGAATGGGACACATAACTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175406
ATP6V0D2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175406.1-1150s1c1
Sequence:CCGGGCCATGAAGTTATTGAGGAAACTCGAGTTTCCTCAATAACTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175406.1-682s1c1
Sequence:CCGGGCAGACGTTATGTGTCCCATTCTCGAGAATGGGACACATAACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175406.1-990s1c1
Sequence:CCGGGCAACTCCATTATGGTGTGTTCTCGAGAACACACCATAATGGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175406.1-869s1c1
Sequence:CCGGTGGCAGATAATTATGGAGTTTCTCGAGAAACTCCATAATTATCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175406.1-374s1c1
Sequence:CCGGGCAGCTATATGATAGACAATACTCGAGTATTGTCTATCATATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175406
ATP6V0D2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175406.1-1150s1c1
Sequence:CCGGGCCATGAAGTTATTGAGGAAACTCGAGTTTCCTCAATAACTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175406.1-682s1c1
Sequence:CCGGGCAGACGTTATGTGTCCCATTCTCGAGAATGGGACACATAACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175406.1-990s1c1
Sequence:CCGGGCAACTCCATTATGGTGTGTTCTCGAGAACACACCATAATGGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175406.1-869s1c1
Sequence:CCGGTGGCAGATAATTATGGAGTTTCTCGAGAAACTCCATAATTATCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175406.1-374s1c1
Sequence:CCGGGCAGCTATATGATAGACAATACTCGAGTATTGTCTATCATATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175406
ATP6V0D2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 38kDa, V0 subunit d2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101390    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175406.1-1150s1c1
Sequence:CCGGGCCATGAAGTTATTGAGGAAACTCGAGTTTCCTCAATAACTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101391    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175406.1-682s1c1
Sequence:CCGGGCAGACGTTATGTGTCCCATTCTCGAGAATGGGACACATAACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175406.1-990s1c1
Sequence:CCGGGCAACTCCATTATGGTGTGTTCTCGAGAACACACCATAATGGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101394    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175406.1-869s1c1
Sequence:CCGGTGGCAGATAATTATGGAGTTTCTCGAGAAACTCCATAATTATCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175406.1-374s1c1
Sequence:CCGGGCAGCTATATGATAGACAATACTCGAGTATTGTCTATCATATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks