EMAIL THIS PAGE TO A FRIEND

ATP6V0E1

ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1

47 Gene Product Result for
Synonyms: ATP6H ATP6V0E M9.2 Vma21 Vma21p
UniProtKB ID: O15342, B2R557, D3DQM1, Q6IBE8
Gene ID:
Human(8992) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is possibly part of the V0 subunit. Since two nontranscribed pseudogenes have been found in dog, it is possible that the localization to chromosome 2 for this gene by radiation hybrid mapping is representing a pseudogene. Genomic mapping puts the chromosomal location on 5q35.3. [provided by RefSeq, Jul 2008]
Rat(94170) ATPase, H+ transporting, lysosomal, V0 subunit e1
naked mole-rat(101726308) ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1
domestic guinea pig(100726215) ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1
sheep(101108422) ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1
chicken(768854) ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1
cow(338075) ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1
domestic cat(101091676) ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1
dog(403729) ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003945 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003945 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003945 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014181 MISSION® esiRNA esiRNA targeting human ATP6V0E (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003945 Rosetta Predictions human pricing
NM_053578 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003945 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147902 predicted 540
2 SASI_Hs02_00336602 predicted 590
3 SASI_Hs01_00147903 predicted 460
4 SASI_Hs02_00336603 predicted 278
5 SASI_Hs01_00147904 predicted 229
6 SASI_Hs01_00147906 predicted 412
7 SASI_Hs01_00147908 predicted 257
8 SASI_Hs01_00147909 predicted 359
9 SASI_Hs01_00147910 predicted 583
10 SASI_Hs01_00147911 predicted 382
11 SASI_Hs01_00147905 predicted 213
12 SASI_Hs01_00147907 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053578 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050843 predicted 231
2 SASI_Rn01_00050844 predicted 596
3 SASI_Rn01_00050845 predicted 256
4 SASI_Rn01_00050846 predicted 443
5 SASI_Rn01_00050847 predicted 200
6 SASI_Rn01_00050848 predicted 280
7 SASI_Rn01_00050849 predicted 591
8 SASI_Rn02_00266247 predicted 391
9 SASI_Rn01_00050850 predicted 381
10 SASI_Rn01_00050851 predicted 436
11 SASI_Rn01_00050852 predicted 549
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003945
VALIDATED
ATP6V0E1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003945.3-347s21c1
Sequence:GTACCGGAGGAAGAAGACATGCTCTACACTCGAGTGTAGAGCATGTCTTCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003945.3-462s21c1
Sequence:GTACCGGATTAGCTGCCTTAAACGTTAACTCGAGTTAACGTTTAAGGCAGCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003945.3-233s21c1
Sequence:GTACCGGTTCAGTTTGCTGCTATCTCTTCTCGAGAAGAGATAGCAGCAAACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003945.3-262s21c1
Sequence:GTACCGGTTGCAATTCTGGCCCAACTCACTCGAGTGAGTTGGGCCAGAATTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003945.3-180s21c1
Sequence:CCGGTTCATCCCTAAGGGTCCTAACCTCGAGGTTAGGACCCTTAGGGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003945.3-319s21c1
Sequence:CCGGTCTGGTATCTGAAGTATCATTCTCGAGAATGATACTTCAGATACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003945.3-284s21c1
Sequence:CCGGCCCTCTCTTTGGACCGCAATTCTCGAGAATTGCGGTCCAAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003945.2-666s1c1
Sequence:CCGGCGTGGGAATCAGTGAAGTGTTCTCGAGAACACTTCACTGATTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003945.2-258s1c1
Sequence:CCGGCCCTCTCTTTGGACCGCAATTCTCGAGAATTGCGGTCCAAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003945.2-153s1c1
Sequence:CCGGGTTCATCCCTAAGGGTCCTAACTCGAGTTAGGACCCTTAGGGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003945.2-135s1c1
Sequence:CCGGCGGCTTCTTGGTGCCTTGGTTCTCGAGAACCAAGGCACCAAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003945.2-293s1c1
Sequence:CCGGTCTGGTATCTGAAGTATCATTCTCGAGAATGATACTTCAGATACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003945
VALIDATED
ATP6V0E1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003945.3-347s21c1
Sequence:GTACCGGAGGAAGAAGACATGCTCTACACTCGAGTGTAGAGCATGTCTTCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003945.3-462s21c1
Sequence:GTACCGGATTAGCTGCCTTAAACGTTAACTCGAGTTAACGTTTAAGGCAGCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003945.3-233s21c1
Sequence:GTACCGGTTCAGTTTGCTGCTATCTCTTCTCGAGAAGAGATAGCAGCAAACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003945.3-262s21c1
Sequence:GTACCGGTTGCAATTCTGGCCCAACTCACTCGAGTGAGTTGGGCCAGAATTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003945.3-180s21c1
Sequence:CCGGTTCATCCCTAAGGGTCCTAACCTCGAGGTTAGGACCCTTAGGGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003945.3-319s21c1
Sequence:CCGGTCTGGTATCTGAAGTATCATTCTCGAGAATGATACTTCAGATACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003945.3-284s21c1
Sequence:CCGGCCCTCTCTTTGGACCGCAATTCTCGAGAATTGCGGTCCAAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003945.2-666s1c1
Sequence:CCGGCGTGGGAATCAGTGAAGTGTTCTCGAGAACACTTCACTGATTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003945.2-258s1c1
Sequence:CCGGCCCTCTCTTTGGACCGCAATTCTCGAGAATTGCGGTCCAAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003945.2-153s1c1
Sequence:CCGGGTTCATCCCTAAGGGTCCTAACTCGAGTTAGGACCCTTAGGGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003945.2-135s1c1
Sequence:CCGGCGGCTTCTTGGTGCCTTGGTTCTCGAGAACCAAGGCACCAAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003945.2-293s1c1
Sequence:CCGGTCTGGTATCTGAAGTATCATTCTCGAGAATGATACTTCAGATACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003945
VALIDATED
ATP6V0E1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 9kDa, V0 subunit e1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003945.3-347s21c1
Sequence:GTACCGGAGGAAGAAGACATGCTCTACACTCGAGTGTAGAGCATGTCTTCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218669    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003945.3-462s21c1
Sequence:GTACCGGATTAGCTGCCTTAAACGTTAACTCGAGTTAACGTTTAAGGCAGCTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003945.3-233s21c1
Sequence:GTACCGGTTCAGTTTGCTGCTATCTCTTCTCGAGAAGAGATAGCAGCAAACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003945.3-262s21c1
Sequence:GTACCGGTTGCAATTCTGGCCCAACTCACTCGAGTGAGTTGGGCCAGAATTGCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003945.3-180s21c1
Sequence:CCGGTTCATCCCTAAGGGTCCTAACCTCGAGGTTAGGACCCTTAGGGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003945.3-319s21c1
Sequence:CCGGTCTGGTATCTGAAGTATCATTCTCGAGAATGATACTTCAGATACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003945.3-284s21c1
Sequence:CCGGCCCTCTCTTTGGACCGCAATTCTCGAGAATTGCGGTCCAAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038519    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003945.2-666s1c1
Sequence:CCGGCGTGGGAATCAGTGAAGTGTTCTCGAGAACACTTCACTGATTCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038520    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003945.2-258s1c1
Sequence:CCGGCCCTCTCTTTGGACCGCAATTCTCGAGAATTGCGGTCCAAAGAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003945.2-153s1c1
Sequence:CCGGGTTCATCCCTAAGGGTCCTAACTCGAGTTAGGACCCTTAGGGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038523    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003945.2-135s1c1
Sequence:CCGGCGGCTTCTTGGTGCCTTGGTTCTCGAGAACCAAGGCACCAAGAAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003945.2-293s1c1
Sequence:CCGGTCTGGTATCTGAAGTATCATTCTCGAGAATGATACTTCAGATACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks