EMAIL THIS PAGE TO A FRIEND

ATP6V0E2-AS1

ATP6V0E2 antisense RNA 1

52 Gene Product Result for
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001008745 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008745 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008745 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008745 Rosetta Predictions human pricing
XR_040272 Rosetta Predictions human pricing
XR_040273 Rosetta Predictions human pricing
XR_040274 Rosetta Predictions human pricing
XR_040275 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008745 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034129 predicted 664
2 SASI_Hs01_00034130 predicted 529
3 SASI_Hs01_00034131 predicted 753
4 SASI_Hs01_00034132 predicted 210
5 SASI_Hs01_00034133 predicted 841
6 SASI_Hs01_00034134 predicted 769
7 SASI_Hs01_00034135 predicted 590
8 SASI_Hs01_00034136 predicted 879
9 SASI_Hs01_00034137 predicted 838
10 SASI_Hs01_00034138 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040272 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517416 predicted 278
2 SASI_Hs02_00517417 predicted 337
3 SASI_Hs02_00517418 predicted 279
4 SASI_Hs02_00517419 predicted 282
5 SASI_Hs02_00517420 predicted 194
6 SASI_Hs02_00517421 predicted 284
7 SASI_Hs02_00517422 predicted 212
8 SASI_Hs02_00517423 predicted 357
9 SASI_Hs02_00517424 predicted 111
10 SASI_Hs02_00517425 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040273 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517426 predicted 278
2 SASI_Hs02_00517427 predicted 340
3 SASI_Hs02_00517428 predicted 287
4 SASI_Hs02_00517429 predicted 275
5 SASI_Hs02_00517430 predicted 193
6 SASI_Hs02_00517431 predicted 280
7 SASI_Hs02_00517432 predicted 211
8 SASI_Hs02_00517433 predicted 355
9 SASI_Hs02_00517434 predicted 120
10 SASI_Hs02_00517435 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517436 predicted 280
2 SASI_Hs02_00517437 predicted 342
3 SASI_Hs02_00517438 predicted 280
4 SASI_Hs02_00517439 predicted 282
5 SASI_Hs02_00517440 predicted 200
6 SASI_Hs02_00517441 predicted 280
7 SASI_Hs02_00517442 predicted 209
8 SASI_Hs02_00517443 predicted 360
9 SASI_Hs02_00517444 predicted 118
10 SASI_Hs02_00517445 predicted 788
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00517446 predicted 284
2 SASI_Hs02_00517447 predicted 336
3 SASI_Hs02_00517448 predicted 285
4 SASI_Hs02_00517449 predicted 283
5 SASI_Hs02_00517450 predicted 202
6 SASI_Hs02_00517451 predicted 288
7 SASI_Hs02_00517452 predicted 213
8 SASI_Hs02_00517453 predicted 357
9 SASI_Hs02_00517454 predicted 114
10 SASI_Hs02_00517455 predicted 789
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008745
ATP6V0E2-AS1 MISSION shRNA Bacterial Glycerol Stock
ATP6V0E2 antisense RNA 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000172270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008745.1-44s1c1
Sequence:CCGGCGTCACGCCGCATTCTTATTTCTCGAGAAATAAGAATGCGGCGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008745.1-584s1c1
Sequence:CCGGGAGGTCCATGAAGGGATTAAACTCGAGTTTAATCCCTTCATGGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168550    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008745.1-2612s1c1
Sequence:CCGGGCCTCTGTTTCCATAGTTGTTCTCGAGAACAACTATGGAAACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008745.1-50s1c1
Sequence:CCGGGCCGCATTCTTATTTCCAAAGCTCGAGCTTTGGAAATAAGAATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008745
ATP6V0E2-AS1 MISSION shRNA shRNA Plasmid DNA
ATP6V0E2 antisense RNA 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000172270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008745.1-44s1c1
Sequence:CCGGCGTCACGCCGCATTCTTATTTCTCGAGAAATAAGAATGCGGCGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008745.1-584s1c1
Sequence:CCGGGAGGTCCATGAAGGGATTAAACTCGAGTTTAATCCCTTCATGGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168550    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008745.1-2612s1c1
Sequence:CCGGGCCTCTGTTTCCATAGTTGTTCTCGAGAACAACTATGGAAACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008745.1-50s1c1
Sequence:CCGGGCCGCATTCTTATTTCCAAAGCTCGAGCTTTGGAAATAAGAATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008745
ATP6V0E2-AS1 MISSION shRNA Lentiviral Transduction Particles
ATP6V0E2 antisense RNA 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000172270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008745.1-44s1c1
Sequence:CCGGCGTCACGCCGCATTCTTATTTCTCGAGAAATAAGAATGCGGCGTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168592    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008745.1-584s1c1
Sequence:CCGGGAGGTCCATGAAGGGATTAAACTCGAGTTTAATCCCTTCATGGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168550    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001008745.1-2612s1c1
Sequence:CCGGGCCTCTGTTTCCATAGTTGTTCTCGAGAACAACTATGGAAACAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168441    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008745.1-50s1c1
Sequence:CCGGGCCGCATTCTTATTTCCAAAGCTCGAGCTTTGGAAATAAGAATGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks