EMAIL THIS PAGE TO A FRIEND

ATP6V0E2

ATPase, H+ transporting V0 subunit e2

81 Gene Product Result for
Synonyms: ATP6V0E2L C7orf32
Gene ID:
Human(155066) Summary: Multisubunit vacuolar-type proton pumps, or H(+)-ATPases, acidify various intracellular compartments, such as vacuoles, clathrin-coated and synaptic vesicles, endosomes, lysosomes, and chromaffin granules. H(+)-ATPases are also found in plasma membranes of specialized cells, where they play roles in urinary acidification, bone resorption, and sperm maturation. Multiple subunits form H(+)-ATPases, with proteins of the V1 class hydrolyzing ATP for energy to transport H+, and proteins of the V0 class forming an integral membrane domain through which H+ is transported. ATP6V0E2 encodes an isoform of the H(+)-ATPase V0 e subunit, an essential proton pump component (Blake-Palmer et al., 2007 [PubMed 17350184]
Mouse(76252) ATPase, H+ transporting, lysosomal V0 subunit E2
Rat(436582) ATPase, H+ transporting V0 subunit e2
chicken(769770) ATPase, H+ transporting V0 subunit e2
domestic cat(101093093) ATPase, H+ transporting V0 subunit e2
cow(505224) ATPase, H+ transporting V0 subunit e2
dog(482789) ATPase, H+ transporting V0 subunit e2
sheep(101122020) ATPase, H+ transporting V0 subunit e2
domestic guinea pig(100713097) ATPase, H+ transporting V0 subunit e2
naked mole-rat(101723774) ATPase, H+ transporting V0 subunit e2
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2103456 Anti-ATP6V0E2 antibody produced in rabbit affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_088142 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_088142 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_088142 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133764 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133764 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133764 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_145230 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145230 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145230 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100592 Rosetta Predictions human pricing
NM_145230 Rosetta Predictions human pricing
NM_001002253 Rosetta Predictions rat pricing
NM_133764 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00322174 predicted 1740
2 SASI_Hs02_00322175 predicted 1852
3 SASI_Hs02_00322176 predicted 1936
4 SASI_Hs02_00322177 predicted 1744
5 SASI_Hs02_00322178 predicted 1499
6 SASI_Hs02_00322179 predicted 2016
7 SASI_Hs02_00322180 predicted 1696
8 SASI_Hs02_00322181 predicted 1718
9 SASI_Hs02_00322182 predicted 1841
10 SASI_Hs02_00322183 predicted 1907
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145230 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014597 predicted 1812
2 SASI_Hs02_00365062 predicted 1827
3 SASI_Hs01_00014593 predicted 1368
4 SASI_Hs01_00014594 predicted 1608
5 SASI_Hs01_00014595 predicted 1123
6 SASI_Hs01_00014596 predicted 1180
7 SASI_Hs02_00365063 predicted 1092
8 SASI_Hs02_00365064 predicted 1091
9 SASI_Hs02_00365065 predicted 1111
10 SASI_Hs02_00365066 predicted 1193
11 SASI_Hs01_00014598 predicted 2656
12 SASI_Hs01_00014599 predicted 2685
13 SASI_Hs01_00014600 predicted 2262
14 SASI_Hs01_00014601 predicted 2056
15 SASI_Hs01_00014602 predicted 1862
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002253 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085844 predicted 413
2 SASI_Rn01_00085845 predicted 254
3 SASI_Rn02_00197964 predicted 202
4 SASI_Rn01_00085846 predicted 344
5 SASI_Rn01_00085847 predicted 417
6 SASI_Rn01_00085848 predicted 472
7 SASI_Rn01_00085851 predicted 422
8 SASI_Rn01_00085852 predicted 607
9 SASI_Rn01_00085853 predicted 584
10 SASI_Rn02_00197965 predicted 284
11 SASI_Rn01_00085849 predicted 210
12 SASI_Rn01_00085850 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133764 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114940 predicted 843
2 SASI_Mm01_00114941 predicted 645
3 SASI_Mm02_00338764 predicted 289
4 SASI_Mm01_00114943 predicted 673
5 SASI_Mm01_00114944 predicted 769
6 SASI_Mm01_00114946 predicted 554
7 SASI_Mm01_00114948 predicted 673
8 SASI_Mm01_00114949 predicted 590
9 SASI_Mm02_00338765 predicted 438
10 SASI_Mm02_00338766 predicted 652
11 SASI_Mm01_00114942 predicted 484
12 SASI_Mm01_00114945 predicted 556
13 SASI_Mm01_00114947 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_088142
VALIDATED
ATP6V0E2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting V0 subunit e2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:XM_088142.5-434s1c1
Sequence:CCGGCCACACAACTATGTCTGGTCACTCGAGTGACCAGACATAGTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088142.5-345s1c1
Sequence:CCGGCCAGCTGAAGAATGAGACCATCTCGAGATGGTCTCATTCTTCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:XM_088142.5-605s1c1
Sequence:CCGGGCTCTGGAGTTTGCCCTCTTTCTCGAGAAAGAGGGCAAACTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:XM_088142.5-903s1c1
Sequence:CCGGCAGAGAAACATTCACACACAACTCGAGTTGTGTGTGAATGTTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_088142.5-288s1c1
Sequence:CCGGCTGTTACCTCTTCTGGCTCATCTCGAGATGAGCCAGAAGAGGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_088142
VALIDATED
ATP6V0E2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting V0 subunit e2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:XM_088142.5-434s1c1
Sequence:CCGGCCACACAACTATGTCTGGTCACTCGAGTGACCAGACATAGTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088142.5-345s1c1
Sequence:CCGGCCAGCTGAAGAATGAGACCATCTCGAGATGGTCTCATTCTTCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:XM_088142.5-605s1c1
Sequence:CCGGGCTCTGGAGTTTGCCCTCTTTCTCGAGAAAGAGGGCAAACTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:XM_088142.5-903s1c1
Sequence:CCGGCAGAGAAACATTCACACACAACTCGAGTTGTGTGTGAATGTTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_088142.5-288s1c1
Sequence:CCGGCTGTTACCTCTTCTGGCTCATCTCGAGATGAGCCAGAAGAGGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_088142
VALIDATED
ATP6V0E2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting V0 subunit e2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:XM_088142.5-434s1c1
Sequence:CCGGCCACACAACTATGTCTGGTCACTCGAGTGACCAGACATAGTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_088142.5-345s1c1
Sequence:CCGGCCAGCTGAAGAATGAGACCATCTCGAGATGGTCTCATTCTTCAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:XM_088142.5-605s1c1
Sequence:CCGGGCTCTGGAGTTTGCCCTCTTTCTCGAGAAAGAGGGCAAACTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:XM_088142.5-903s1c1
Sequence:CCGGCAGAGAAACATTCACACACAACTCGAGTTGTGTGTGAATGTTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:XM_088142.5-288s1c1
Sequence:CCGGCTGTTACCTCTTCTGGCTCATCTCGAGATGAGCCAGAAGAGGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133764
VALIDATED
ATP6V0E2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting V0 subunit e2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000080917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-325s1c1
Sequence:CCGGGTTTGGGCCACAACTGAAGAACTCGAGTTCTTCAGTTGTGGCCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-349s1c1
Sequence:CCGGGACCATCTGGTACGTGCGTTTCTCGAGAAACGCACGTACCAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-246s1c1
Sequence:CCGGTCATCACCATGCTGGTAGCTACTCGAGTAGCTACCAGCATGGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-334s1c1
Sequence:CCGGACAACTGAAGAATGAGACCATCTCGAGATGGTCTCATTCTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000080913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-687s1c1
Sequence:CCGGCCCTCTTTCTTCCAAGCAGATCTCGAGATCTGCTTGGAAGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133764
VALIDATED
ATP6V0E2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting V0 subunit e2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000080917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-325s1c1
Sequence:CCGGGTTTGGGCCACAACTGAAGAACTCGAGTTCTTCAGTTGTGGCCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-349s1c1
Sequence:CCGGGACCATCTGGTACGTGCGTTTCTCGAGAAACGCACGTACCAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-246s1c1
Sequence:CCGGTCATCACCATGCTGGTAGCTACTCGAGTAGCTACCAGCATGGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-334s1c1
Sequence:CCGGACAACTGAAGAATGAGACCATCTCGAGATGGTCTCATTCTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000080913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-687s1c1
Sequence:CCGGCCCTCTTTCTTCCAAGCAGATCTCGAGATCTGCTTGGAAGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133764
VALIDATED
ATP6V0E2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting V0 subunit e2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000080917    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-325s1c1
Sequence:CCGGGTTTGGGCCACAACTGAAGAACTCGAGTTCTTCAGTTGTGGCCCAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-349s1c1
Sequence:CCGGGACCATCTGGTACGTGCGTTTCTCGAGAAACGCACGTACCAGATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-246s1c1
Sequence:CCGGTCATCACCATGCTGGTAGCTACTCGAGTAGCTACCAGCATGGTGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-334s1c1
Sequence:CCGGACAACTGAAGAATGAGACCATCTCGAGATGGTCTCATTCTTCAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000080913    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_133764.2-687s1c1
Sequence:CCGGCCCTCTTTCTTCCAAGCAGATCTCGAGATCTGCTTGGAAGAAAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145230
VALIDATED
ATP6V0E2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting V0 subunit e2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145230.2-1113s21c1
Sequence:GTACCGGATTCGCCCTCCCGGTCATCATCTCGAGATGATGACCGGGAGGGCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145230.2-1898s21c1
Sequence:CCGGCAGAGAAACATTCACACACAACTCGAGTTGTGTGTGAATGTTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_145230.2-1600s21c1
Sequence:CCGGGCTCTGGAGTTTGCCCTCTTTCTCGAGAAAGAGGGCAAACTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_145230.2-1429s21c1
Sequence:CCGGCCACACAACTATGTCTGGTCACTCGAGTGACCAGACATAGTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_145230.2-1239s21c1
Sequence:CCGGCTGTTACCTCTTCTGGCTCATCTCGAGATGAGCCAGAAGAGGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145230.2-1200s21c1
Sequence:GTACCGGCGGAGTGATCATCACCATGCTCTCGAGAGCATGGTGATGATCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145230.2-1298s21c1
Sequence:GTACCGGAGCTGAAGAATGAGACCATCTCTCGAGAGATGGTCTCATTCTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145230
VALIDATED
ATP6V0E2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting V0 subunit e2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145230.2-1113s21c1
Sequence:GTACCGGATTCGCCCTCCCGGTCATCATCTCGAGATGATGACCGGGAGGGCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145230.2-1898s21c1
Sequence:CCGGCAGAGAAACATTCACACACAACTCGAGTTGTGTGTGAATGTTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_145230.2-1600s21c1
Sequence:CCGGGCTCTGGAGTTTGCCCTCTTTCTCGAGAAAGAGGGCAAACTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_145230.2-1429s21c1
Sequence:CCGGCCACACAACTATGTCTGGTCACTCGAGTGACCAGACATAGTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_145230.2-1239s21c1
Sequence:CCGGCTGTTACCTCTTCTGGCTCATCTCGAGATGAGCCAGAAGAGGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145230.2-1200s21c1
Sequence:GTACCGGCGGAGTGATCATCACCATGCTCTCGAGAGCATGGTGATGATCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145230.2-1298s21c1
Sequence:GTACCGGAGCTGAAGAATGAGACCATCTCTCGAGAGATGGTCTCATTCTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145230
VALIDATED
ATP6V0E2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting V0 subunit e2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145230.2-1113s21c1
Sequence:GTACCGGATTCGCCCTCCCGGTCATCATCTCGAGATGATGACCGGGAGGGCGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307213    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145230.2-1898s21c1
Sequence:CCGGCAGAGAAACATTCACACACAACTCGAGTTGTGTGTGAATGTTTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_145230.2-1600s21c1
Sequence:CCGGGCTCTGGAGTTTGCCCTCTTTCTCGAGAAAGAGGGCAAACTCCAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_145230.2-1429s21c1
Sequence:CCGGCCACACAACTATGTCTGGTCACTCGAGTGACCAGACATAGTTGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_145230.2-1239s21c1
Sequence:CCGGCTGTTACCTCTTCTGGCTCATCTCGAGATGAGCCAGAAGAGGTAACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381914    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145230.2-1200s21c1
Sequence:GTACCGGCGGAGTGATCATCACCATGCTCTCGAGAGCATGGTGATGATCACTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145230.2-1298s21c1
Sequence:GTACCGGAGCTGAAGAATGAGACCATCTCTCGAGAGATGGTCTCATTCTTCAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks