EMAIL THIS PAGE TO A FRIEND

ATP6V1A

ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A

Synonyms: ATP6A1 ATP6V1A1 HO68 VA68 VPP2 Vma1
UniProtKB ID: P38606, B2RBR8, D3DN75, Q53YD9, Q96DY6, Q9UHY3
Gene ID:
Human(523) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain A subunit isoforms and is found in all tissues. Transcript variants derived from alternative polyadenylation exist. [provided by RefSeq, Jul 2008]
Mouse(11964) ATPase, H+ transporting, lysosomal V1 subunit A
Rat(685232) ATPase, H+ transporting, lysosomal V1 subunit A
chicken(395821) ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
cow(282147) ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
domestic cat(101091723) ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
dog(487981) ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
naked mole-rat(101717344) ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
domestic guinea pig(100733879) ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
sheep(101102025) ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
Domestic Rabbit(100347673) ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
198 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001690 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001690 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001690 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001690 Rosetta Predictions human pricing
NM_001108318 Rosetta Predictions rat pricing
XM_001058034 Rosetta Predictions rat pricing
XM_001058095 Rosetta Predictions rat pricing
NM_007508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332352 predicted 1889
2 SASI_Hs01_00131585 predicted 1087
3 SASI_Hs01_00131586 predicted 1856
4 SASI_Hs02_00332353 predicted 1627
5 SASI_Hs02_00332354 predicted 1010
6 SASI_Hs01_00131588 predicted 1050
7 SASI_Hs01_00131589 predicted 441
8 SASI_Hs01_00131590 predicted 572
9 SASI_Hs01_00131591 predicted 949
10 SASI_Hs01_00131592 predicted 956
11 SASI_Hs01_00131587 predicted 867
12 SASI_Hs01_00131593 predicted 374
13 SASI_Hs01_00131594 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108318 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237479 predicted 348
2 SASI_Rn02_00237480 predicted 1200
3 SASI_Rn02_00237481 predicted 554
4 SASI_Rn02_00237482 predicted 987
5 SASI_Rn02_00237483 predicted 1647
6 SASI_Rn02_00237484 predicted 1726
7 SASI_Rn02_00237485 predicted 1363
8 SASI_Rn02_00237486 predicted 250
9 SASI_Rn02_00237487 predicted 308
10 SASI_Rn02_00237488 predicted 1730
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058034 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288335 predicted 338
2 SASI_Rn02_00288336 predicted 1189
3 SASI_Rn02_00288337 predicted 536
4 SASI_Rn02_00288338 predicted 974
5 SASI_Rn02_00288339 predicted 1642
6 SASI_Rn02_00288340 predicted 1717
7 SASI_Rn02_00288341 predicted 1355
8 SASI_Rn02_00288342 predicted 292
9 SASI_Rn02_00288343 predicted 1711
10 SASI_Rn02_00288344 predicted 319
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00288574 predicted 411
2 SASI_Rn02_00288575 predicted 1265
3 SASI_Rn02_00288576 predicted 617
4 SASI_Rn02_00288577 predicted 1050
5 SASI_Rn02_00288578 predicted 1720
6 SASI_Rn02_00288579 predicted 1795
7 SASI_Rn02_00288580 predicted 1430
8 SASI_Rn02_00288581 predicted 376
9 SASI_Rn02_00288582 predicted 1797
10 SASI_Rn02_00288583 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149101 predicted 522
2 SASI_Mm01_00149102 predicted 459
3 SASI_Mm01_00149103 predicted 1865
4 SASI_Mm02_00311800 predicted 1237
5 SASI_Mm01_00149104 predicted 1896
6 SASI_Mm02_00311801 predicted 617
7 SASI_Mm01_00149106 predicted 311
8 SASI_Mm02_00311802 predicted 249
9 SASI_Mm01_00149107 predicted 1693
10 SASI_Mm01_00149108 predicted 1563
11 SASI_Mm01_00149105 predicted 1771
12 SASI_Mm01_00149109 predicted 706
13 SASI_Mm01_00149110 predicted 601
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007508
VALIDATED
ATP6V1A MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-1833s1c1
Sequence:CCGGGCAAAGATCAAGGCCGACTATCTCGAGATAGTCGGCCTTGATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-2367s1c1
Sequence:CCGGGCAGGAAATACTTCCATTTAACTCGAGTTAAATGGAAGTATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-1980s1c1
Sequence:CCGGGCTTCCATATTGTGCAGCTTTCTCGAGAAAGCTGCACAATATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-234s1c1
Sequence:CCGGGCCACCATTCAGGTGTATGAACTCGAGTTCATACACCTGAATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-1673s1c1
Sequence:CCGGGTCCAACATGATTTCATTCTACTCGAGTAGAATGAAATCATGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007508.2-1546s1c1
Sequence:CCGGCCTCTTTAGCAGAGACGGATACTCGAGTATCCGTCTCTGCTAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007508.5-1570s21c1
Sequence:CCGGTCTTTAGCAGAGACGGATAAACTCGAGTTTATCCGTCTCTGCTAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007508.5-492s21c1
Sequence:CCGGCCTACGGGTTGGTAGTCATATCTCGAGATATGACTACCAACCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007508.5-1090s21c1
Sequence:CCGGATGGGCTACCACGTCAGTATGCTCGAGCATACTGACGTGGTAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007508.5-1761s21c1
Sequence:CCGGTAAGATCACATGGTCCATTATCTCGAGATAATGGACCATGTGATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007508
VALIDATED
ATP6V1A MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-1833s1c1
Sequence:CCGGGCAAAGATCAAGGCCGACTATCTCGAGATAGTCGGCCTTGATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-2367s1c1
Sequence:CCGGGCAGGAAATACTTCCATTTAACTCGAGTTAAATGGAAGTATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-1980s1c1
Sequence:CCGGGCTTCCATATTGTGCAGCTTTCTCGAGAAAGCTGCACAATATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-234s1c1
Sequence:CCGGGCCACCATTCAGGTGTATGAACTCGAGTTCATACACCTGAATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-1673s1c1
Sequence:CCGGGTCCAACATGATTTCATTCTACTCGAGTAGAATGAAATCATGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007508.2-1546s1c1
Sequence:CCGGCCTCTTTAGCAGAGACGGATACTCGAGTATCCGTCTCTGCTAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007508.5-1570s21c1
Sequence:CCGGTCTTTAGCAGAGACGGATAAACTCGAGTTTATCCGTCTCTGCTAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007508.5-492s21c1
Sequence:CCGGCCTACGGGTTGGTAGTCATATCTCGAGATATGACTACCAACCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007508.5-1090s21c1
Sequence:CCGGATGGGCTACCACGTCAGTATGCTCGAGCATACTGACGTGGTAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007508.5-1761s21c1
Sequence:CCGGTAAGATCACATGGTCCATTATCTCGAGATAATGGACCATGTGATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007508
VALIDATED
ATP6V1A MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-1833s1c1
Sequence:CCGGGCAAAGATCAAGGCCGACTATCTCGAGATAGTCGGCCTTGATCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177330    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-2367s1c1
Sequence:CCGGGCAGGAAATACTTCCATTTAACTCGAGTTAAATGGAAGTATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181559    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-1980s1c1
Sequence:CCGGGCTTCCATATTGTGCAGCTTTCTCGAGAAAGCTGCACAATATGGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-234s1c1
Sequence:CCGGGCCACCATTCAGGTGTATGAACTCGAGTTCATACACCTGAATGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 1.5 Clone ID:NM_007508.2-1673s1c1
Sequence:CCGGGTCCAACATGATTTCATTCTACTCGAGTAGAATGAAATCATGTTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182110    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007508.2-1546s1c1
Sequence:CCGGCCTCTTTAGCAGAGACGGATACTCGAGTATCCGTCTCTGCTAAAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007508.5-1570s21c1
Sequence:CCGGTCTTTAGCAGAGACGGATAAACTCGAGTTTATCCGTCTCTGCTAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007508.5-492s21c1
Sequence:CCGGCCTACGGGTTGGTAGTCATATCTCGAGATATGACTACCAACCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007508.5-1090s21c1
Sequence:CCGGATGGGCTACCACGTCAGTATGCTCGAGCATACTGACGTGGTAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_007508.5-1761s21c1
Sequence:CCGGTAAGATCACATGGTCCATTATCTCGAGATAATGGACCATGTGATCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001690
VALIDATED
ATP6V1A MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001690.2-1235s1c1
Sequence:CCGGGCAGGGTGAAATGTCTTGGAACTCGAGTTCCAAGACATTTCACCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001690.2-1832s1c1
Sequence:CCGGCACTGAAAGATGGTGAGGCAACTCGAGTTGCCTCACCATCTTTCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001690.2-1686s1c1
Sequence:CCGGGCTGTCCAACATGATTGCATTCTCGAGAATGCAATCATGTTGGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001690.2-486s1c1
Sequence:CCGGCCTACGGGTTGGTAGTCATATCTCGAGATATGACTACCAACCCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001690.2-340s1c1
Sequence:CCGGCCTGGCATTATGGGAGCCATTCTCGAGAATGGCTCCCATAATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001690.2-963s21c1
Sequence:CCGGTGGTAAGGTAGAGTCAATTATCTCGAGATAATTGACTCTACCTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001690.2-845s21c1
Sequence:CCGGCACAGTCTCTATCCAAGTATTCTCGAGAATACTTGGATAGAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001690.2-2139s21c1
Sequence:CCGGTGAAGTGGTGAATATAGTAAACTCGAGTTTACTATATTCACCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001690.2-1419s21c1
Sequence:CCGGCATCAGCTACAGCAAGTATATCTCGAGATATACTTGCTGTAGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001690.2-486s21c1
Sequence:CCGGCCTACGGGTTGGTAGTCATATCTCGAGATATGACTACCAACCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001690
VALIDATED
ATP6V1A MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001690.2-1235s1c1
Sequence:CCGGGCAGGGTGAAATGTCTTGGAACTCGAGTTCCAAGACATTTCACCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001690.2-1832s1c1
Sequence:CCGGCACTGAAAGATGGTGAGGCAACTCGAGTTGCCTCACCATCTTTCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001690.2-1686s1c1
Sequence:CCGGGCTGTCCAACATGATTGCATTCTCGAGAATGCAATCATGTTGGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001690.2-486s1c1
Sequence:CCGGCCTACGGGTTGGTAGTCATATCTCGAGATATGACTACCAACCCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001690.2-340s1c1
Sequence:CCGGCCTGGCATTATGGGAGCCATTCTCGAGAATGGCTCCCATAATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001690.2-963s21c1
Sequence:CCGGTGGTAAGGTAGAGTCAATTATCTCGAGATAATTGACTCTACCTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001690.2-845s21c1
Sequence:CCGGCACAGTCTCTATCCAAGTATTCTCGAGAATACTTGGATAGAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001690.2-2139s21c1
Sequence:CCGGTGAAGTGGTGAATATAGTAAACTCGAGTTTACTATATTCACCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001690.2-1419s21c1
Sequence:CCGGCATCAGCTACAGCAAGTATATCTCGAGATATACTTGCTGTAGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001690.2-486s21c1
Sequence:CCGGCCTACGGGTTGGTAGTCATATCTCGAGATATGACTACCAACCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001690
VALIDATED
ATP6V1A MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 70kDa, V1 subunit A
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001690.2-1235s1c1
Sequence:CCGGGCAGGGTGAAATGTCTTGGAACTCGAGTTCCAAGACATTTCACCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001690.2-1832s1c1
Sequence:CCGGCACTGAAAGATGGTGAGGCAACTCGAGTTGCCTCACCATCTTTCAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001690.2-1686s1c1
Sequence:CCGGGCTGTCCAACATGATTGCATTCTCGAGAATGCAATCATGTTGGACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029542    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001690.2-486s1c1
Sequence:CCGGCCTACGGGTTGGTAGTCATATCTCGAGATATGACTACCAACCCGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001690.2-340s1c1
Sequence:CCGGCCTGGCATTATGGGAGCCATTCTCGAGAATGGCTCCCATAATGCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001690.2-963s21c1
Sequence:CCGGTGGTAAGGTAGAGTCAATTATCTCGAGATAATTGACTCTACCTTACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001690.2-845s21c1
Sequence:CCGGCACAGTCTCTATCCAAGTATTCTCGAGAATACTTGGATAGAGACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297914    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001690.2-2139s21c1
Sequence:CCGGTGAAGTGGTGAATATAGTAAACTCGAGTTTACTATATTCACCACTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001690.2-1419s21c1
Sequence:CCGGCATCAGCTACAGCAAGTATATCTCGAGATATACTTGCTGTAGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001690.2-486s21c1
Sequence:CCGGCCTACGGGTTGGTAGTCATATCTCGAGATATGACTACCAACCCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks