EMAIL THIS PAGE TO A FRIEND

ATP6V1B1

ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1

55 Gene Product Result for
Synonyms: ATP6B1 RTA1B VATB VMA2 VPP3
UniProtKB ID: P15313, Q53FY0, Q6P4H6
Gene ID:
Human(525) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain B subunit isoforms and is found in the kidney. Mutations in this gene cause distal renal tubular acidosis associated with sensorineural deafness. [provided by RefSeq, Jul 2008]
Mouse(110935) ATPase, H+ transporting, lysosomal V1 subunit B1
Rat(312488) ATPase, H transporting, lysosomal V1 subunit B1
domestic cat(101098295) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
cow(338059) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
Horse(100050282) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
dog(474628) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
sheep(101107683) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
domestic guinea pig(100724011) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
naked mole-rat(101720999) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134157 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134157 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134157 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001692 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001692 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001692 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017741 MISSION® esiRNA esiRNA targeting human ATP6V1B1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001692 Rosetta Predictions human pricing
NM_001107867 Rosetta Predictions rat pricing
NM_134157 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001692 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098246 predicted 1556
2 SASI_Hs01_00098247 predicted 736
3 SASI_Hs01_00098249 predicted 249
4 SASI_Hs01_00098250 predicted 1165
5 SASI_Hs01_00098251 predicted 263
6 SASI_Hs02_00332355 predicted 505
7 SASI_Hs01_00098252 predicted 561
8 SASI_Hs02_00332356 predicted 587
9 SASI_Hs02_00332357 predicted 421
10 SASI_Hs01_00098253 predicted 1330
11 SASI_Hs01_00098248 predicted 907
12 SASI_Hs01_00098254 predicted 790
13 SASI_Hs01_00098255 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107867 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233065 predicted 1096
2 SASI_Rn02_00233066 predicted 1027
3 SASI_Rn02_00233067 predicted 536
4 SASI_Rn02_00233068 predicted 925
5 SASI_Rn02_00233069 predicted 835
6 SASI_Rn02_00233070 predicted 1274
7 SASI_Rn02_00233071 predicted 492
8 SASI_Rn02_00233072 predicted 951
9 SASI_Rn02_00233073 predicted 358
10 SASI_Rn02_00233074 predicted 831
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134157 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104069 predicted 549
2 SASI_Mm01_00104071 predicted 1026
3 SASI_Mm01_00104072 predicted 715
4 SASI_Mm01_00104073 predicted 928
5 SASI_Mm01_00104074 predicted 1627
6 SASI_Mm01_00104075 predicted 840
7 SASI_Mm01_00104076 predicted 242
8 SASI_Mm01_00104077 predicted 1658
9 SASI_Mm01_00104078 predicted 1276
10 SASI_Mm02_00339422 predicted 368
11 SASI_Mm01_00104070 predicted 794
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134157
ATP6V1B1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134157.2-1184s21c1
Sequence:CCGGTGTGGACCGACAGCTACATAACTCGAGTTATGTAGCTGTCGGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134157.2-350s21c1
Sequence:CCGGAGGGACTTCAGGGATTGATTCCTCGAGGAATCAATCCCTGAAGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134157.2-1629s1c1
Sequence:CCGGCCTTCTCCTTTATGGCTTGAACTCGAGTTCAAGCCATAAAGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134157.2-1248s1c1
Sequence:CCGGCGACTGATGAAGTCGGCCATACTCGAGTATGGCCGACTTCATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134157.2-251s1c1
Sequence:CCGGGTATGCTGAGATTGTCAACTTCTCGAGAAGTTGACAATCTCAGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134157.2-782s1c1
Sequence:CCGGCAAGTCAGATTTCGAGCAGAACTCGAGTTCTGCTCGAAATCTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134157.2-1502s1c1
Sequence:CCGGGCGCATCTTTCCGAAAGAGATCTCGAGATCTCTTTCGGAAAGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134157
ATP6V1B1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134157.2-1184s21c1
Sequence:CCGGTGTGGACCGACAGCTACATAACTCGAGTTATGTAGCTGTCGGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134157.2-350s21c1
Sequence:CCGGAGGGACTTCAGGGATTGATTCCTCGAGGAATCAATCCCTGAAGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134157.2-1629s1c1
Sequence:CCGGCCTTCTCCTTTATGGCTTGAACTCGAGTTCAAGCCATAAAGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134157.2-1248s1c1
Sequence:CCGGCGACTGATGAAGTCGGCCATACTCGAGTATGGCCGACTTCATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134157.2-251s1c1
Sequence:CCGGGTATGCTGAGATTGTCAACTTCTCGAGAAGTTGACAATCTCAGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134157.2-782s1c1
Sequence:CCGGCAAGTCAGATTTCGAGCAGAACTCGAGTTCTGCTCGAAATCTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134157.2-1502s1c1
Sequence:CCGGGCGCATCTTTCCGAAAGAGATCTCGAGATCTCTTTCGGAAAGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134157
ATP6V1B1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134157.2-1184s21c1
Sequence:CCGGTGTGGACCGACAGCTACATAACTCGAGTTATGTAGCTGTCGGTCCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134157.2-350s21c1
Sequence:CCGGAGGGACTTCAGGGATTGATTCCTCGAGGAATCAATCCCTGAAGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134157.2-1629s1c1
Sequence:CCGGCCTTCTCCTTTATGGCTTGAACTCGAGTTCAAGCCATAAAGGAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134157.2-1248s1c1
Sequence:CCGGCGACTGATGAAGTCGGCCATACTCGAGTATGGCCGACTTCATCAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134157.2-251s1c1
Sequence:CCGGGTATGCTGAGATTGTCAACTTCTCGAGAAGTTGACAATCTCAGCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134157.2-782s1c1
Sequence:CCGGCAAGTCAGATTTCGAGCAGAACTCGAGTTCTGCTCGAAATCTGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134157.2-1502s1c1
Sequence:CCGGGCGCATCTTTCCGAAAGAGATCTCGAGATCTCTTTCGGAAAGATGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001692
ATP6V1B1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001692.3-392s21c1
Sequence:CCGGGGAAGACCACTTGCGAATTTACTCGAGTAAATTCGCAAGTGGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001692.3-950s21c1
Sequence:CCGGTGGTCATACTGACGGACATGACTCGAGTCATGTCCGTCAGTATGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001692.3-1134s21c1
Sequence:CCGGCATGCCCAACGACGATATCACCTCGAGGTGATATCGTCGTTGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-327s1c1
Sequence:CCGGGCGATTGTTCAGGTGTTTGAACTCGAGTTCAAACACCTGAACAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-1539s1c1
Sequence:CCGGGCCGTGATCGACGAGTTCTATCTCGAGATAGAACTCGTCGATCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-231s1c1
Sequence:CCGGCGGGTCAAGTTTGCCCAGTATCTCGAGATACTGGGCAAACTTGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-1006s1c1
Sequence:CCGGGCCGAGGGTTTCCTGGATATACTCGAGTATATCCAGGAAACCCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-704s1c1
Sequence:CCGGGCTGGATTACCATGACGACAACTCGAGTTGTCGTCATGGTAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001692
ATP6V1B1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001692.3-392s21c1
Sequence:CCGGGGAAGACCACTTGCGAATTTACTCGAGTAAATTCGCAAGTGGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001692.3-950s21c1
Sequence:CCGGTGGTCATACTGACGGACATGACTCGAGTCATGTCCGTCAGTATGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001692.3-1134s21c1
Sequence:CCGGCATGCCCAACGACGATATCACCTCGAGGTGATATCGTCGTTGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-327s1c1
Sequence:CCGGGCGATTGTTCAGGTGTTTGAACTCGAGTTCAAACACCTGAACAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-1539s1c1
Sequence:CCGGGCCGTGATCGACGAGTTCTATCTCGAGATAGAACTCGTCGATCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-231s1c1
Sequence:CCGGCGGGTCAAGTTTGCCCAGTATCTCGAGATACTGGGCAAACTTGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-1006s1c1
Sequence:CCGGGCCGAGGGTTTCCTGGATATACTCGAGTATATCCAGGAAACCCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-704s1c1
Sequence:CCGGGCTGGATTACCATGACGACAACTCGAGTTGTCGTCATGGTAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001692
ATP6V1B1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001692.3-392s21c1
Sequence:CCGGGGAAGACCACTTGCGAATTTACTCGAGTAAATTCGCAAGTGGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001692.3-950s21c1
Sequence:CCGGTGGTCATACTGACGGACATGACTCGAGTCATGTCCGTCAGTATGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424637    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001692.3-1134s21c1
Sequence:CCGGCATGCCCAACGACGATATCACCTCGAGGTGATATCGTCGTTGGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-327s1c1
Sequence:CCGGGCGATTGTTCAGGTGTTTGAACTCGAGTTCAAACACCTGAACAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-1539s1c1
Sequence:CCGGGCCGTGATCGACGAGTTCTATCTCGAGATAGAACTCGTCGATCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-231s1c1
Sequence:CCGGCGGGTCAAGTTTGCCCAGTATCTCGAGATACTGGGCAAACTTGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-1006s1c1
Sequence:CCGGGCCGAGGGTTTCCTGGATATACTCGAGTATATCCAGGAAACCCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001692.2-704s1c1
Sequence:CCGGGCTGGATTACCATGACGACAACTCGAGTTGTCGTCATGGTAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks