EMAIL THIS PAGE TO A FRIEND

ATP6V1B2

ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2

145 Gene Product Result for
Synonyms: ATP6B1B2 ATP6B2 HO57 VATB VPP3 Vma2
UniProtKB ID: P21281, B2R5Z3, D3DSQ5, Q14544, Q15859, Q96IR0
Gene ID:
Human(526) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A, three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. The protein encoded by this gene is one of two V1 domain B subunit isoforms and is the only B isoform highly expressed in osteoclasts. [provided by RefSeq, Jul 2008]
Mouse(11966) ATPase, H+ transporting, lysosomal V1 subunit B2
Rat(117596) ATPase, H transporting, lysosomal V1 subunit B2
naked mole-rat(101704199) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
domestic guinea pig(100726524) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
sheep(494439) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
Zebrafish(359840) ATPase, H+ transporting, lysosomal V1 subunit B2
cow(338082) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
domestic cat(101092601) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
dog(486137) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
chicken(395497) ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001693 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001693 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001693 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007509 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007509 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007509 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001693 Rosetta Predictions human pricing
NM_057213 Rosetta Predictions rat pricing
NM_007509 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001693 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141852 predicted 603
2 SASI_Hs01_00141853 predicted 1280
3 SASI_Hs01_00141854 predicted 1446
4 SASI_Hs01_00141855 predicted 583
5 SASI_Hs01_00141856 predicted 461
6 SASI_Hs02_00332358 predicted 435
7 SASI_Hs01_00141857 predicted 1470
8 SASI_Hs01_00141858 predicted 390
9 SASI_Hs01_00141859 predicted 737
10 SASI_Hs01_00141861 predicted 1252
11 SASI_Hs01_00141860 predicted 851
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057213 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054988 predicted 1098
2 SASI_Rn01_00054989 predicted 1038
3 SASI_Rn01_00054990 predicted 214
4 SASI_Rn01_00054991 predicted 381
5 SASI_Rn01_00054993 predicted 229
6 SASI_Rn02_00267173 predicted 1060
7 SASI_Rn01_00054994 predicted 1077
8 SASI_Rn02_00267174 predicted 1290
9 SASI_Rn01_00054996 predicted 1576
10 SASI_Rn01_00054997 predicted 1492
11 SASI_Rn01_00054992 predicted 619
12 SASI_Rn01_00054995 predicted 1352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007509 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00200440 predicted 295
2 SASI_Mm01_00200441 predicted 1218
3 SASI_Mm01_00200442 predicted 1008
4 SASI_Mm01_00200444 predicted 390
5 SASI_Mm02_00311803 predicted 664
6 SASI_Mm01_00200445 predicted 220
7 SASI_Mm01_00200446 predicted 263
8 SASI_Mm01_00200447 predicted 458
9 SASI_Mm01_00200448 predicted 240
10 SASI_Mm01_00200449 predicted 548
11 SASI_Mm01_00200443 predicted 1652
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001693
VALIDATED
ATP6V1B2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-1392s1c1
Sequence:CCGGGCCCTCACTATCACGGTTAATCTCGAGATTAACCGTGATAGTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-337s1c1
Sequence:CCGGCGCCTCACATACAAGACAGTACTCGAGTACTGTCTTGTATGTGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-1454s1c1
Sequence:CCGGCCGATGTATCTAACCAGCTATCTCGAGATAGCTGGTTAGATACATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-930s1c1
Sequence:CCGGCCGGTTCTTCAAATCTGACTTCTCGAGAAGTCAGATTTGAAGAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-1051s1c1
Sequence:CCGGGCTGAATTTCTGGCGTACCAACTCGAGTTGGTACGCCAGAAATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-1058s21c1
Sequence:CCGGGCTGAATTTCTGGCGTACCAACTCGAGTTGGTACGCCAGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-1461s21c1
Sequence:CCGGCCGATGTATCTAACCAGCTATCTCGAGATAGCTGGTTAGATACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-937s21c1
Sequence:CCGGCCGGTTCTTCAAATCTGACTTCTCGAGAAGTCAGATTTGAAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-1399s21c1
Sequence:CCGGGCCCTCACTATCACGGTTAATCTCGAGATTAACCGTGATAGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-2017s21c1
Sequence:CCGGCATAGTGGAGTAGTTAGTTACCTCGAGGTAACTAACTACTCCACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001693
VALIDATED
ATP6V1B2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-1392s1c1
Sequence:CCGGGCCCTCACTATCACGGTTAATCTCGAGATTAACCGTGATAGTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-337s1c1
Sequence:CCGGCGCCTCACATACAAGACAGTACTCGAGTACTGTCTTGTATGTGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-1454s1c1
Sequence:CCGGCCGATGTATCTAACCAGCTATCTCGAGATAGCTGGTTAGATACATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-930s1c1
Sequence:CCGGCCGGTTCTTCAAATCTGACTTCTCGAGAAGTCAGATTTGAAGAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-1051s1c1
Sequence:CCGGGCTGAATTTCTGGCGTACCAACTCGAGTTGGTACGCCAGAAATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-1058s21c1
Sequence:CCGGGCTGAATTTCTGGCGTACCAACTCGAGTTGGTACGCCAGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-1461s21c1
Sequence:CCGGCCGATGTATCTAACCAGCTATCTCGAGATAGCTGGTTAGATACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-937s21c1
Sequence:CCGGCCGGTTCTTCAAATCTGACTTCTCGAGAAGTCAGATTTGAAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-1399s21c1
Sequence:CCGGGCCCTCACTATCACGGTTAATCTCGAGATTAACCGTGATAGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-2017s21c1
Sequence:CCGGCATAGTGGAGTAGTTAGTTACCTCGAGGTAACTAACTACTCCACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001693
VALIDATED
ATP6V1B2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-1392s1c1
Sequence:CCGGGCCCTCACTATCACGGTTAATCTCGAGATTAACCGTGATAGTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-337s1c1
Sequence:CCGGCGCCTCACATACAAGACAGTACTCGAGTACTGTCTTGTATGTGAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-1454s1c1
Sequence:CCGGCCGATGTATCTAACCAGCTATCTCGAGATAGCTGGTTAGATACATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-930s1c1
Sequence:CCGGCCGGTTCTTCAAATCTGACTTCTCGAGAAGTCAGATTTGAAGAACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001693.2-1051s1c1
Sequence:CCGGGCTGAATTTCTGGCGTACCAACTCGAGTTGGTACGCCAGAAATTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-1058s21c1
Sequence:CCGGGCTGAATTTCTGGCGTACCAACTCGAGTTGGTACGCCAGAAATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-1461s21c1
Sequence:CCGGCCGATGTATCTAACCAGCTATCTCGAGATAGCTGGTTAGATACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-937s21c1
Sequence:CCGGCCGGTTCTTCAAATCTGACTTCTCGAGAAGTCAGATTTGAAGAACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-1399s21c1
Sequence:CCGGGCCCTCACTATCACGGTTAATCTCGAGATTAACCGTGATAGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322816    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001693.3-2017s21c1
Sequence:CCGGCATAGTGGAGTAGTTAGTTACCTCGAGGTAACTAACTACTCCACTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007509
VALIDATED
ATP6V1B2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007509.2-1874s1c1
Sequence:CCGGCCTACCTCTCAACTCCCTTAACTCGAGTTAAGGGAGTTGAGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007509.2-1179s1c1
Sequence:CCGGGACAGATTTACCCTCCTATTACTCGAGTAATAGGAGGGTAAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007509.2-188s1c1
Sequence:CCGGCCACTAGTGATCCTAGATCATCTCGAGATGATCTAGGATCACTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007509.2-2358s1c1
Sequence:CCGGCCGTGAGACGACTTGCTTTAACTCGAGTTAAAGCAAGTCGTCTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007509.2-1119s1c1
Sequence:CCGGCTGACTTGACTGGGTACATTACTCGAGTAATGTACCCAGTCAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-1119s21c1
Sequence:CCGGCTGACTTGACTGGGTACATTACTCGAGTAATGTACCCAGTCAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-1874s21c1
Sequence:CCGGCCTACCTCTCAACTCCCTTAACTCGAGTTAAGGGAGTTGAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-188s21c1
Sequence:CCGGCCACTAGTGATCCTAGATCATCTCGAGATGATCTAGGATCACTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-2358s21c1
Sequence:CCGGCCGTGAGACGACTTGCTTTAACTCGAGTTAAAGCAAGTCGTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-1179s21c1
Sequence:CCGGGACAGATTTACCCTCCTATTACTCGAGTAATAGGAGGGTAAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007509
VALIDATED
ATP6V1B2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007509.2-1874s1c1
Sequence:CCGGCCTACCTCTCAACTCCCTTAACTCGAGTTAAGGGAGTTGAGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007509.2-1179s1c1
Sequence:CCGGGACAGATTTACCCTCCTATTACTCGAGTAATAGGAGGGTAAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007509.2-188s1c1
Sequence:CCGGCCACTAGTGATCCTAGATCATCTCGAGATGATCTAGGATCACTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007509.2-2358s1c1
Sequence:CCGGCCGTGAGACGACTTGCTTTAACTCGAGTTAAAGCAAGTCGTCTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007509.2-1119s1c1
Sequence:CCGGCTGACTTGACTGGGTACATTACTCGAGTAATGTACCCAGTCAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-1119s21c1
Sequence:CCGGCTGACTTGACTGGGTACATTACTCGAGTAATGTACCCAGTCAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-1874s21c1
Sequence:CCGGCCTACCTCTCAACTCCCTTAACTCGAGTTAAGGGAGTTGAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-188s21c1
Sequence:CCGGCCACTAGTGATCCTAGATCATCTCGAGATGATCTAGGATCACTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-2358s21c1
Sequence:CCGGCCGTGAGACGACTTGCTTTAACTCGAGTTAAAGCAAGTCGTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-1179s21c1
Sequence:CCGGGACAGATTTACCCTCCTATTACTCGAGTAATAGGAGGGTAAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007509
VALIDATED
ATP6V1B2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182127    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007509.2-1874s1c1
Sequence:CCGGCCTACCTCTCAACTCCCTTAACTCGAGTTAAGGGAGTTGAGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007509.2-1179s1c1
Sequence:CCGGGACAGATTTACCCTCCTATTACTCGAGTAATAGGAGGGTAAATCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007509.2-188s1c1
Sequence:CCGGCCACTAGTGATCCTAGATCATCTCGAGATGATCTAGGATCACTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007509.2-2358s1c1
Sequence:CCGGCCGTGAGACGACTTGCTTTAACTCGAGTTAAAGCAAGTCGTCTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007509.2-1119s1c1
Sequence:CCGGCTGACTTGACTGGGTACATTACTCGAGTAATGTACCCAGTCAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-1119s21c1
Sequence:CCGGCTGACTTGACTGGGTACATTACTCGAGTAATGTACCCAGTCAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-1874s21c1
Sequence:CCGGCCTACCTCTCAACTCCCTTAACTCGAGTTAAGGGAGTTGAGAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-188s21c1
Sequence:CCGGCCACTAGTGATCCTAGATCATCTCGAGATGATCTAGGATCACTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278732    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-2358s21c1
Sequence:CCGGCCGTGAGACGACTTGCTTTAACTCGAGTTAAAGCAAGTCGTCTCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007509.2-1179s21c1
Sequence:CCGGGACAGATTTACCCTCCTATTACTCGAGTAATAGGAGGGTAAATCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks