EMAIL THIS PAGE TO A FRIEND

ATP6V1C1

ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1

138 Gene Product Result for
Synonyms: ATP6C ATP6D VATC Vma5
UniProtKB ID: P21283
Gene ID:
Human(528) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of intracellular compartments of eukaryotic cells. V-ATPase dependent acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene is one of two genes that encode the V1 domain C subunit proteins and is found ubiquitously. This C subunit is analogous but not homologous to gamma subunit of F-ATPases. Previously, this gene was designated ATP6D. [provided by RefSeq, Jul 2008]
Mouse(66335) ATPase, H+ transporting, lysosomal V1 subunit C1
Rat(299971) ATPase, H+ transporting, lysosomal V1 subunit C1
chicken(420259) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
dog(475061) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
cow(338089) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
domestic cat(101084001) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
sheep(101122445) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
Domestic Rabbit(100343886) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
domestic guinea pig(100725980) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
naked mole-rat(101721955) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025494 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025494 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025494 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001695 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001695 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001695 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007254 Rosetta Predictions human pricing
NM_001695 Rosetta Predictions human pricing
NM_001011992 Rosetta Predictions rat pricing
XM_576255 Rosetta Predictions rat pricing
NM_025494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00187526 predicted 869
2 SASI_Hs01_00187527 predicted 1125
3 SASI_Hs01_00187528 predicted 610
4 SASI_Hs01_00187529 predicted 1047
5 SASI_Hs01_00187530 predicted 1174
6 SASI_Hs01_00187531 predicted 687
7 SASI_Hs01_00187532 predicted 804
8 SASI_Hs01_00187533 predicted 557
9 SASI_Hs01_00187534 predicted 757
10 SASI_Hs01_00187535 predicted 1062
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001695 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071153 predicted 940
2 SASI_Hs02_00332360 predicted 411
3 SASI_Hs01_00071154 predicted 1201
4 SASI_Hs02_00332361 predicted 471
5 SASI_Hs01_00071156 predicted 1121
6 SASI_Hs01_00071158 predicted 754
7 SASI_Hs01_00071159 predicted 870
8 SASI_Hs01_00071160 predicted 620
9 SASI_Hs01_00071161 predicted 824
10 SASI_Hs02_00332362 predicted 402
11 SASI_Hs01_00071155 predicted 657
12 SASI_Hs01_00071157 predicted 1222
13 SASI_Hs01_00071162 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055424 predicted 945
2 SASI_Rn01_00055426 predicted 200
3 SASI_Rn01_00055427 predicted 1040
4 SASI_Rn01_00055428 predicted 479
5 SASI_Rn01_00055429 predicted 623
6 SASI_Rn02_00200024 predicted 555
7 SASI_Rn01_00055432 predicted 562
8 SASI_Rn02_00200025 predicted 878
9 SASI_Rn02_00200026 predicted 626
10 SASI_Rn01_00055433 predicted 767
11 SASI_Rn01_00055425 predicted 767
12 SASI_Rn01_00055430 predicted 602
13 SASI_Rn01_00055431 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00146924 predicted 1013
2 SASI_Rn01_00146925 predicted 838
3 SASI_Rn01_00146926 predicted 277
4 SASI_Rn01_00146927 predicted 1120
5 SASI_Rn01_00146928 predicted 549
6 SASI_Rn01_00146929 predicted 699
7 SASI_Rn01_00146930 predicted 676
8 SASI_Rn01_00146931 predicted 1148
9 SASI_Rn01_00146932 predicted 641
10 SASI_Rn01_00146933 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00153558 predicted 840
2 SASI_Mm01_00153560 predicted 721
3 SASI_Mm01_00153561 predicted 902
4 SASI_Mm01_00153562 predicted 803
5 SASI_Mm02_00328367 predicted 1382
6 SASI_Mm01_00153564 predicted 982
7 SASI_Mm02_00328368 predicted 1401
8 SASI_Mm02_00328369 predicted 1078
9 SASI_Mm01_00153565 predicted 319
10 SASI_Mm01_00153563 predicted 684
11 SASI_Mm01_00153559 predicted 1033
12 SASI_Mm01_00153566 predicted 609
13 SASI_Mm01_00153567 predicted 554
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025494
VALIDATED
ATP6V1C1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025494.3-285s21c1
Sequence:CCGGGCGACCACCAAGAACAATAATCTCGAGATTATTGTTCTTGGTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025494.3-1314s21c1
Sequence:CCGGCCCTATGTGTATTACAAGATTCTCGAGAATCTTGTAATACACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025494.3-1178s21c1
Sequence:CCGGGCCGAATAAGAAGTCAGTGAACTCGAGTTCACTGACTTCTTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025494.3-633s21c1
Sequence:CCGGTCTGCATACAATAACCTGAAACTCGAGTTTCAGGTTATTGTATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-236s1c1
Sequence:CCGGGCGACCACCAAGAACAATAATCTCGAGATTATTGTTCTTGGTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-1265s1c1
Sequence:CCGGCCCTATGTGTATTACAAGATTCTCGAGAATCTTGTAATACACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-1129s1c1
Sequence:CCGGGCCGAATAAGAAGTCAGTGAACTCGAGTTCACTGACTTCTTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-1003s1c1
Sequence:CCGGGCGGTGGCTTAAAGTGAATTTCTCGAGAAATTCACTTTAAGCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-584s1c1
Sequence:CCGGTCTGCATACAATAACCTGAAACTCGAGTTTCAGGTTATTGTATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025494
VALIDATED
ATP6V1C1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025494.3-285s21c1
Sequence:CCGGGCGACCACCAAGAACAATAATCTCGAGATTATTGTTCTTGGTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025494.3-1314s21c1
Sequence:CCGGCCCTATGTGTATTACAAGATTCTCGAGAATCTTGTAATACACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025494.3-1178s21c1
Sequence:CCGGGCCGAATAAGAAGTCAGTGAACTCGAGTTCACTGACTTCTTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025494.3-633s21c1
Sequence:CCGGTCTGCATACAATAACCTGAAACTCGAGTTTCAGGTTATTGTATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-236s1c1
Sequence:CCGGGCGACCACCAAGAACAATAATCTCGAGATTATTGTTCTTGGTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-1265s1c1
Sequence:CCGGCCCTATGTGTATTACAAGATTCTCGAGAATCTTGTAATACACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-1129s1c1
Sequence:CCGGGCCGAATAAGAAGTCAGTGAACTCGAGTTCACTGACTTCTTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-1003s1c1
Sequence:CCGGGCGGTGGCTTAAAGTGAATTTCTCGAGAAATTCACTTTAAGCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-584s1c1
Sequence:CCGGTCTGCATACAATAACCTGAAACTCGAGTTTCAGGTTATTGTATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025494
VALIDATED
ATP6V1C1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025494.3-285s21c1
Sequence:CCGGGCGACCACCAAGAACAATAATCTCGAGATTATTGTTCTTGGTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025494.3-1314s21c1
Sequence:CCGGCCCTATGTGTATTACAAGATTCTCGAGAATCTTGTAATACACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025494.3-1178s21c1
Sequence:CCGGGCCGAATAAGAAGTCAGTGAACTCGAGTTCACTGACTTCTTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025494.3-633s21c1
Sequence:CCGGTCTGCATACAATAACCTGAAACTCGAGTTTCAGGTTATTGTATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-236s1c1
Sequence:CCGGGCGACCACCAAGAACAATAATCTCGAGATTATTGTTCTTGGTGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-1265s1c1
Sequence:CCGGCCCTATGTGTATTACAAGATTCTCGAGAATCTTGTAATACACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-1129s1c1
Sequence:CCGGGCCGAATAAGAAGTCAGTGAACTCGAGTTCACTGACTTCTTATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-1003s1c1
Sequence:CCGGGCGGTGGCTTAAAGTGAATTTCTCGAGAAATTCACTTTAAGCCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025494.1-584s1c1
Sequence:CCGGTCTGCATACAATAACCTGAAACTCGAGTTTCAGGTTATTGTATGCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001695
VALIDATED
ATP6V1C1 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001695.4-1198s21c1
Sequence:CCGGCAATGCTACTTCAGCCCAATACTCGAGTATTGGGCTGAAGTAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001695.4-316s21c1
Sequence:CCGGCGGCAACTTCAAAGAACAATACTCGAGTATTGTTCTTTGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001695.4-1347s21c1
Sequence:CCGGCCCTATGTGTACTACAAGATTCTCGAGAATCTTGTAGTACACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001695.4-902s21c1
Sequence:CCGGCCAAGACAGTTACCTGTGTAACTCGAGTTACACAGGTAACTGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001695.2-399s1c1
Sequence:CCGGGCTCAATACATGGCTGATGTACTCGAGTACATCAGCCATGTATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001695.2-253s1c1
Sequence:CCGGCGGCAACTTCAAAGAACAATACTCGAGTATTGTTCTTTGAAGTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001695.2-1135s1c1
Sequence:CCGGCAATGCTACTTCAGCCCAATACTCGAGTATTGGGCTGAAGTAGCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001695
VALIDATED
ATP6V1C1 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001695.4-1198s21c1
Sequence:CCGGCAATGCTACTTCAGCCCAATACTCGAGTATTGGGCTGAAGTAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001695.4-316s21c1
Sequence:CCGGCGGCAACTTCAAAGAACAATACTCGAGTATTGTTCTTTGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001695.4-1347s21c1
Sequence:CCGGCCCTATGTGTACTACAAGATTCTCGAGAATCTTGTAGTACACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001695.4-902s21c1
Sequence:CCGGCCAAGACAGTTACCTGTGTAACTCGAGTTACACAGGTAACTGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001695.2-399s1c1
Sequence:CCGGGCTCAATACATGGCTGATGTACTCGAGTACATCAGCCATGTATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001695.2-253s1c1
Sequence:CCGGCGGCAACTTCAAAGAACAATACTCGAGTATTGTTCTTTGAAGTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001695.2-1135s1c1
Sequence:CCGGCAATGCTACTTCAGCCCAATACTCGAGTATTGGGCTGAAGTAGCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001695
VALIDATED
ATP6V1C1 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001695.4-1198s21c1
Sequence:CCGGCAATGCTACTTCAGCCCAATACTCGAGTATTGGGCTGAAGTAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001695.4-316s21c1
Sequence:CCGGCGGCAACTTCAAAGAACAATACTCGAGTATTGTTCTTTGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319281    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001695.4-1347s21c1
Sequence:CCGGCCCTATGTGTACTACAAGATTCTCGAGAATCTTGTAGTACACATAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319280    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001695.4-902s21c1
Sequence:CCGGCCAAGACAGTTACCTGTGTAACTCGAGTTACACAGGTAACTGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001695.2-399s1c1
Sequence:CCGGGCTCAATACATGGCTGATGTACTCGAGTACATCAGCCATGTATTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001695.2-253s1c1
Sequence:CCGGCGGCAACTTCAAAGAACAATACTCGAGTATTGTTCTTTGAAGTTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001695.2-1135s1c1
Sequence:CCGGCAATGCTACTTCAGCCCAATACTCGAGTATTGGGCTGAAGTAGCATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks