EMAIL THIS PAGE TO A FRIEND

ATP6V1C2

ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2

Synonyms: ATP6C2 VMA5
UniProtKB ID: Q8NEY4, Q96EL8
Gene ID:
Human(245973) Summary: This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A,three B, and two G subunits, as well as a C, D, E, F, and H subunit. The V1 domain contains the ATP catalytic site. This gene encodes alternate transcriptional splice variants, encoding different V1 domain C subunit isoforms. [provided by RefSeq, Jul 2008]
Mouse(68775) ATPase, H+ transporting, lysosomal V1 subunit C2
Rat(362802) ATPase, H+ transporting, lysosomal V1 subunit C2
chicken(421939) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
domestic cat(101086301) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
Horse(100057005) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
cow(508327) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
dog(475667) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
naked mole-rat(101726403) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
domestic guinea pig(100716597) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
sheep(101103310) ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
Gene Class: ATPase
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144583 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144583 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144583 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133699 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133699 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133699 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039362 Rosetta Predictions human pricing
NM_144583 Rosetta Predictions human pricing
NM_001014199 Rosetta Predictions rat pricing
NM_133699 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079599 predicted 1449
2 SASI_Hs01_00079600 predicted 1461
3 SASI_Hs01_00079601 predicted 1329
4 SASI_Hs01_00079602 predicted 1411
5 SASI_Hs01_00079603 predicted 1370
6 SASI_Hs01_00079604 predicted 634
7 SASI_Hs01_00079605 predicted 385
8 SASI_Hs01_00079606 predicted 390
9 SASI_Hs01_00079607 predicted 1459
10 SASI_Hs01_00079608 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144583 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239066 predicted 1315
2 SASI_Hs01_00239067 predicted 1325
3 SASI_Hs01_00239068 predicted 1189
4 SASI_Hs01_00239069 predicted 1272
5 SASI_Hs01_00239070 predicted 1233
6 SASI_Hs01_00239071 predicted 635
7 SASI_Hs01_00239072 predicted 387
8 SASI_Hs01_00239073 predicted 393
9 SASI_Hs01_00239074 predicted 1321
10 SASI_Hs01_00239075 predicted 333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066940 predicted 1127
2 SASI_Rn01_00066941 predicted 404
3 SASI_Rn01_00066942 predicted 626
4 SASI_Rn01_00066943 predicted 230
5 SASI_Rn01_00066944 predicted 661
6 SASI_Rn01_00066945 predicted 909
7 SASI_Rn01_00066946 predicted 649
8 SASI_Rn01_00066947 predicted 227
9 SASI_Rn01_00066948 predicted 951
10 SASI_Rn01_00066949 predicted 724
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133699 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091801 predicted 939
2 SASI_Mm01_00091802 predicted 551
3 SASI_Mm01_00091803 predicted 804
4 SASI_Mm01_00091804 predicted 1062
5 SASI_Mm01_00091805 predicted 404
6 SASI_Mm01_00091806 predicted 776
7 SASI_Mm01_00091807 predicted 869
8 SASI_Mm01_00091808 predicted 909
9 SASI_Mm01_00091809 predicted 1265
10 SASI_Mm01_00091810 predicted 749
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144583
ATP6V1C2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000043137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-442s1c1
Sequence:CCGGCCTACGACACTCTGAAGACAACTCGAGTTGTCTTCAGAGTGTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-585s1c1
Sequence:CCGGCCCAAACCAAACTACTCACAACTCGAGTTGTGAGTAGTTTGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-1007s1c1
Sequence:CCGGGCGTTTAAGAGAGGTTCTAAACTCGAGTTTAGAACCTCTCTTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-1100s1c1
Sequence:CCGGGCAACTCAATAACCAAGACTACTCGAGTAGTCTTGGTTATTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000043133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-644s1c1
Sequence:CCGGCCCTCGATCAACCAAACTCATCTCGAGATGAGTTTGGTTGATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144583.3-593s21c1
Sequence:CCGGACCCGGACACTGAGTGATATTCTCGAGAATATCACTCAGTGTCCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144583.3-1527s21c1
Sequence:CCGGTTCATGTCTTAACGGCTATTTCTCGAGAAATAGCCGTTAAGACATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144583.3-1214s21c1
Sequence:CCGGCCTTATGTCTACTTCCATATTCTCGAGAATATGGAAGTAGACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144583
ATP6V1C2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000043137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-442s1c1
Sequence:CCGGCCTACGACACTCTGAAGACAACTCGAGTTGTCTTCAGAGTGTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-585s1c1
Sequence:CCGGCCCAAACCAAACTACTCACAACTCGAGTTGTGAGTAGTTTGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-1007s1c1
Sequence:CCGGGCGTTTAAGAGAGGTTCTAAACTCGAGTTTAGAACCTCTCTTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-1100s1c1
Sequence:CCGGGCAACTCAATAACCAAGACTACTCGAGTAGTCTTGGTTATTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000043133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-644s1c1
Sequence:CCGGCCCTCGATCAACCAAACTCATCTCGAGATGAGTTTGGTTGATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144583.3-593s21c1
Sequence:CCGGACCCGGACACTGAGTGATATTCTCGAGAATATCACTCAGTGTCCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144583.3-1527s21c1
Sequence:CCGGTTCATGTCTTAACGGCTATTTCTCGAGAAATAGCCGTTAAGACATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144583.3-1214s21c1
Sequence:CCGGCCTTATGTCTACTTCCATATTCTCGAGAATATGGAAGTAGACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144583
ATP6V1C2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000043137    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-442s1c1
Sequence:CCGGCCTACGACACTCTGAAGACAACTCGAGTTGTCTTCAGAGTGTCGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043135    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-585s1c1
Sequence:CCGGCCCAAACCAAACTACTCACAACTCGAGTTGTGAGTAGTTTGGTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043136    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-1007s1c1
Sequence:CCGGGCGTTTAAGAGAGGTTCTAAACTCGAGTTTAGAACCTCTCTTAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-1100s1c1
Sequence:CCGGGCAACTCAATAACCAAGACTACTCGAGTAGTCTTGGTTATTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000043133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144583.1-644s1c1
Sequence:CCGGCCCTCGATCAACCAAACTCATCTCGAGATGAGTTTGGTTGATCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144583.3-593s21c1
Sequence:CCGGACCCGGACACTGAGTGATATTCTCGAGAATATCACTCAGTGTCCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418951    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144583.3-1527s21c1
Sequence:CCGGTTCATGTCTTAACGGCTATTTCTCGAGAAATAGCCGTTAAGACATGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144583.3-1214s21c1
Sequence:CCGGCCTTATGTCTACTTCCATATTCTCGAGAATATGGAAGTAGACATAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133699
ATP6V1C2 MISSION shRNA Bacterial Glycerol Stock
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000101540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133699.1-900s1c1
Sequence:CCGGCCCTCGGTCAACCAAATTGATCTCGAGATCAATTTGGTTGACCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133699.1-1497s1c1
Sequence:CCGGGCTCAGCAACCAGGACTATTTCTCGAGAAATAGTCCTGGTTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133699.1-1004s1c1
Sequence:CCGGACAAGTTCATTGTCCGGGAATCTCGAGATTCCCGGACAATGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133699.1-461s1c1
Sequence:CCGGCCTTTGCTGAAAGCCTCATAACTCGAGTTATGAGGCTTTCAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133699
ATP6V1C2 MISSION shRNA shRNA Plasmid DNA
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000101540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133699.1-900s1c1
Sequence:CCGGCCCTCGGTCAACCAAATTGATCTCGAGATCAATTTGGTTGACCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133699.1-1497s1c1
Sequence:CCGGGCTCAGCAACCAGGACTATTTCTCGAGAAATAGTCCTGGTTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133699.1-1004s1c1
Sequence:CCGGACAAGTTCATTGTCCGGGAATCTCGAGATTCCCGGACAATGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133699.1-461s1c1
Sequence:CCGGCCTTTGCTGAAAGCCTCATAACTCGAGTTATGAGGCTTTCAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133699
ATP6V1C2 MISSION shRNA Lentiviral Transduction Particles
ATPase, H+ transporting, lysosomal 42kDa, V1 subunit C2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000101540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133699.1-900s1c1
Sequence:CCGGCCCTCGGTCAACCAAATTGATCTCGAGATCAATTTGGTTGACCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133699.1-1497s1c1
Sequence:CCGGGCTCAGCAACCAGGACTATTTCTCGAGAAATAGTCCTGGTTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133699.1-1004s1c1
Sequence:CCGGACAAGTTCATTGTCCGGGAATCTCGAGATTCCCGGACAATGAACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133699.1-461s1c1
Sequence:CCGGCCTTTGCTGAAAGCCTCATAACTCGAGTTATGAGGCTTTCAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks